Incidental Mutation 'R2844:Irx2'
ID251453
Institutional Source Beutler Lab
Gene Symbol Irx2
Ensembl Gene ENSMUSG00000001504
Gene NameIroquois homeobox 2
SynonymsIRX6
MMRRC Submission 040437-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.804) question?
Stock #R2844 (G1)
Quality Score110
Status Validated
Chromosome13
Chromosomal Location72628820-72634198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72631590 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 331 (K331R)
Ref Sequence ENSEMBL: ENSMUSP00000073976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074372] [ENSMUST00000167067] [ENSMUST00000172353]
Predicted Effect probably damaging
Transcript: ENSMUST00000074372
AA Change: K331R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073976
Gene: ENSMUSG00000001504
AA Change: K331R

DomainStartEndE-ValueType
low complexity region 51 64 N/A INTRINSIC
low complexity region 70 78 N/A INTRINSIC
HOX 115 180 1.14e-12 SMART
low complexity region 188 196 N/A INTRINSIC
low complexity region 256 278 N/A INTRINSIC
low complexity region 293 305 N/A INTRINSIC
IRO 325 342 2.28e-5 SMART
low complexity region 346 382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163393
Predicted Effect probably benign
Transcript: ENSMUST00000167067
SMART Domains Protein: ENSMUSP00000127963
Gene: ENSMUSG00000001504

DomainStartEndE-ValueType
HOX 21 86 1.14e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169028
Predicted Effect probably benign
Transcript: ENSMUST00000172353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177421
Meta Mutation Damage Score 0.1688 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IRX2 is a member of the Iroquois homeobox gene family. Members of this family appear to play multiple roles during pattern formation of vertebrate embryos.[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for disruptions in this gene are phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,686,164 I186F probably benign Het
Afg3l1 T C 8: 123,494,939 probably benign Het
Atg4a G A X: 140,992,840 E106K probably benign Het
C130079G13Rik G A 3: 59,936,409 V175I probably benign Het
Ccdc50 A G 16: 27,406,729 E64G probably damaging Het
Celsr3 G T 9: 108,829,308 G997W probably damaging Het
Chd8 C T 14: 52,204,495 E2138K possibly damaging Het
Col19a1 C T 1: 24,559,681 G77E unknown Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Fzr1 G T 10: 81,369,418 T159K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gna13 T C 11: 109,363,125 I51T probably damaging Het
Gorab A G 1: 163,396,806 probably null Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Ints6 A G 14: 62,704,826 V486A probably damaging Het
Lrrc6 A G 15: 66,447,676 probably benign Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Med14 A T X: 12,683,996 H684Q probably benign Het
Olfr384 A T 11: 73,603,383 T268S probably benign Het
Pde5a T C 3: 122,851,708 L755P probably damaging Het
Pex14 A T 4: 148,963,511 I203N probably benign Het
Pi4ka T C 16: 17,350,793 E691G probably damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Pnoc A T 14: 65,404,835 F160I probably damaging Het
Ppfia3 C A 7: 45,356,428 R348L probably damaging Het
Ppil6 A T 10: 41,501,693 probably benign Het
Psmd13 C A 7: 140,897,740 probably benign Het
Psme4 T C 11: 30,845,173 probably benign Het
Rfx3 T C 19: 27,806,786 probably benign Het
Rnase11 A G 14: 51,049,770 L109S probably damaging Het
Rngtt A G 4: 33,368,678 T404A probably benign Het
Sbf1 A G 15: 89,303,218 probably null Het
Sema5b A G 16: 35,659,931 N656S probably damaging Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Thbs1 C T 2: 118,117,628 T423I probably benign Het
Ttc17 A T 2: 94,376,074 Y243* probably null Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zfp648 A T 1: 154,205,135 K347* probably null Het
Zfp84 T G 7: 29,775,333 probably null Het
Other mutations in Irx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02749:Irx2 APN 13 72631310 missense probably damaging 1.00
R0647:Irx2 UTSW 13 72630680 missense probably damaging 1.00
R0783:Irx2 UTSW 13 72632650 critical splice donor site probably null
R0931:Irx2 UTSW 13 72631556 missense possibly damaging 0.71
R0932:Irx2 UTSW 13 72631556 missense possibly damaging 0.71
R1782:Irx2 UTSW 13 72631466 missense probably benign 0.19
R4656:Irx2 UTSW 13 72631298 missense probably damaging 1.00
R4963:Irx2 UTSW 13 72632610 missense possibly damaging 0.71
R5219:Irx2 UTSW 13 72631301 missense probably damaging 1.00
R5523:Irx2 UTSW 13 72631595 missense probably damaging 1.00
R6663:Irx2 UTSW 13 72629129 missense probably damaging 1.00
R7311:Irx2 UTSW 13 72631277 missense probably damaging 0.98
R7411:Irx2 UTSW 13 72629063 start codon destroyed probably null 0.99
R7487:Irx2 UTSW 13 72630620 missense probably damaging 1.00
R7506:Irx2 UTSW 13 72629209 missense probably damaging 1.00
R7792:Irx2 UTSW 13 72631374 missense possibly damaging 0.88
R7953:Irx2 UTSW 13 72629224 missense probably benign 0.02
Z1177:Irx2 UTSW 13 72629089 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGACAAGTTTGAGGACCTGG -3'
(R):5'- GCTGCGTTTAAGTTCCCGTAG -3'

Sequencing Primer
(F):5'- TTTGAGGACCTGGAGGACG -3'
(R):5'- AGTTTGTGTAGTTGCCATAGAAAG -3'
Posted On2014-12-04