Incidental Mutation 'R2844:Rnase11'
ID251455
Institutional Source Beutler Lab
Gene Symbol Rnase11
Ensembl Gene ENSMUSG00000059648
Gene Nameribonuclease, RNase A family, 11 (non-active)
Synonyms
MMRRC Submission 040437-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R2844 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location51049451-51050163 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51049770 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 109 (L109S)
Ref Sequence ENSEMBL: ENSMUSP00000075472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076106]
Predicted Effect probably damaging
Transcript: ENSMUST00000076106
AA Change: L109S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075472
Gene: ENSMUSG00000059648
AA Change: L109S

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,686,164 I186F probably benign Het
Afg3l1 T C 8: 123,494,939 probably benign Het
Atg4a G A X: 140,992,840 E106K probably benign Het
C130079G13Rik G A 3: 59,936,409 V175I probably benign Het
Ccdc50 A G 16: 27,406,729 E64G probably damaging Het
Celsr3 G T 9: 108,829,308 G997W probably damaging Het
Chd8 C T 14: 52,204,495 E2138K possibly damaging Het
Col19a1 C T 1: 24,559,681 G77E unknown Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Fzr1 G T 10: 81,369,418 T159K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gna13 T C 11: 109,363,125 I51T probably damaging Het
Gorab A G 1: 163,396,806 probably null Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Ints6 A G 14: 62,704,826 V486A probably damaging Het
Irx2 A G 13: 72,631,590 K331R probably damaging Het
Lrrc6 A G 15: 66,447,676 probably benign Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Med14 A T X: 12,683,996 H684Q probably benign Het
Olfr384 A T 11: 73,603,383 T268S probably benign Het
Pde5a T C 3: 122,851,708 L755P probably damaging Het
Pex14 A T 4: 148,963,511 I203N probably benign Het
Pi4ka T C 16: 17,350,793 E691G probably damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Pnoc A T 14: 65,404,835 F160I probably damaging Het
Ppfia3 C A 7: 45,356,428 R348L probably damaging Het
Ppil6 A T 10: 41,501,693 probably benign Het
Psmd13 C A 7: 140,897,740 probably benign Het
Psme4 T C 11: 30,845,173 probably benign Het
Rfx3 T C 19: 27,806,786 probably benign Het
Rngtt A G 4: 33,368,678 T404A probably benign Het
Sbf1 A G 15: 89,303,218 probably null Het
Sema5b A G 16: 35,659,931 N656S probably damaging Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Thbs1 C T 2: 118,117,628 T423I probably benign Het
Ttc17 A T 2: 94,376,074 Y243* probably null Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zfp648 A T 1: 154,205,135 K347* probably null Het
Zfp84 T G 7: 29,775,333 probably null Het
Other mutations in Rnase11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Rnase11 APN 14 51049756 missense possibly damaging 0.46
IGL01024:Rnase11 APN 14 51049864 missense probably benign 0.05
R1638:Rnase11 UTSW 14 51049601 missense possibly damaging 0.92
R1809:Rnase11 UTSW 14 51049727 missense probably benign 0.00
R5478:Rnase11 UTSW 14 51049875 missense probably damaging 0.99
R7607:Rnase11 UTSW 14 51049572 missense probably damaging 0.99
R8077:Rnase11 UTSW 14 51049941 missense probably damaging 0.99
Z1176:Rnase11 UTSW 14 51049888 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGATGCTGTGCTCATGGGAC -3'
(R):5'- TTTCACAGGAAGAGATGCAACC -3'

Sequencing Primer
(F):5'- CTGTGCTCATGGGACCTGAG -3'
(R):5'- AGAGATGCAACCTGCTGC -3'
Posted On2014-12-04