Incidental Mutation 'R2844:Pnoc'
ID251461
Institutional Source Beutler Lab
Gene Symbol Pnoc
Ensembl Gene ENSMUSG00000045731
Gene Nameprepronociceptin
SynonymsN23K, Npnc1, N/OFQ, OFQ/N, proorphanin
MMRRC Submission 040437-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R2844 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location65400673-65425472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65404835 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 160 (F160I)
Ref Sequence ENSEMBL: ENSMUSP00000153589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059339] [ENSMUST00000224594]
Predicted Effect probably damaging
Transcript: ENSMUST00000059339
AA Change: F160I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054210
Gene: ENSMUSG00000045731
AA Change: F160I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Opiods_neuropep 20 66 1.4e-20 PFAM
low complexity region 109 131 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000224594
AA Change: F160I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.2378 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: This gene encodes the precursor for neuropeptides that have been implicated in a wide range of physiological roles such as transmission and sensitivity to pain, learning, memory, anxiety and depression, in the central nervous system. The encoded protein is a precursor that is proteolytically processed to generate multiple biologically active peptides including nociceptin and nocistatin which have opposite functions in pain transmission. Mice lacking the encoded protein display increased anxiety, elevated basal pain threshold and impaired adaptation to repeated stress. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele fail to exhibit prostaglandin E2-induced allodynia. Mice homozygous for a different knock-out allele display increased naloxone-precipitated jumping in response to morphine treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,686,164 I186F probably benign Het
Afg3l1 T C 8: 123,494,939 probably benign Het
Atg4a G A X: 140,992,840 E106K probably benign Het
C130079G13Rik G A 3: 59,936,409 V175I probably benign Het
Ccdc50 A G 16: 27,406,729 E64G probably damaging Het
Celsr3 G T 9: 108,829,308 G997W probably damaging Het
Chd8 C T 14: 52,204,495 E2138K possibly damaging Het
Col19a1 C T 1: 24,559,681 G77E unknown Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Fzr1 G T 10: 81,369,418 T159K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gna13 T C 11: 109,363,125 I51T probably damaging Het
Gorab A G 1: 163,396,806 probably null Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Ints6 A G 14: 62,704,826 V486A probably damaging Het
Irx2 A G 13: 72,631,590 K331R probably damaging Het
Lrrc6 A G 15: 66,447,676 probably benign Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Med14 A T X: 12,683,996 H684Q probably benign Het
Olfr384 A T 11: 73,603,383 T268S probably benign Het
Pde5a T C 3: 122,851,708 L755P probably damaging Het
Pex14 A T 4: 148,963,511 I203N probably benign Het
Pi4ka T C 16: 17,350,793 E691G probably damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Ppfia3 C A 7: 45,356,428 R348L probably damaging Het
Ppil6 A T 10: 41,501,693 probably benign Het
Psmd13 C A 7: 140,897,740 probably benign Het
Psme4 T C 11: 30,845,173 probably benign Het
Rfx3 T C 19: 27,806,786 probably benign Het
Rnase11 A G 14: 51,049,770 L109S probably damaging Het
Rngtt A G 4: 33,368,678 T404A probably benign Het
Sbf1 A G 15: 89,303,218 probably null Het
Sema5b A G 16: 35,659,931 N656S probably damaging Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Thbs1 C T 2: 118,117,628 T423I probably benign Het
Ttc17 A T 2: 94,376,074 Y243* probably null Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zfp648 A T 1: 154,205,135 K347* probably null Het
Zfp84 T G 7: 29,775,333 probably null Het
Other mutations in Pnoc
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0989:Pnoc UTSW 14 65404868 missense probably damaging 1.00
R5852:Pnoc UTSW 14 65411222 missense probably benign 0.03
R7816:Pnoc UTSW 14 65401858 missense possibly damaging 0.83
R8210:Pnoc UTSW 14 65405072 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGAAGTCACTTCTTGCCCC -3'
(R):5'- CTGCTCTTTACCAGCCAAAGG -3'

Sequencing Primer
(F):5'- TGCCCCCTGCTAGTTGGTG -3'
(R):5'- CTGAAGAGAATGCCGCGTGTC -3'
Posted On2014-12-04