Mutagenetix > Incidental Mutations

Incidental Mutation 'R2844:Rfx3'

251481

Institutional Source

Beutler Lab

Gene Symbol

Rfx3

Ensembl Gene

ENSMUSG00000040929

Gene Name

regulatory factor X, 3 (influences HLA class II expression)

Synonyms

C230093O12Rik, MRFX3

MMRRC Submission

040437-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2844 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27761721-28011166 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 27806786 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000133461 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046898] [ENSMUST00000165566] [ENSMUST00000172907] [ENSMUST00000173863] [ENSMUST00000174850]

Predicted Effect

probably benign
Transcript: ENSMUST00000046898

SMART Domains

Protein: ENSMUSP00000038760
Gene: ENSMUSG00000040929

Domain	Start	End	E-Value	Type
Pfam:RFX1_trans_act	1	140	6.3e-58	PFAM
Pfam:RFX_DNA_binding	150	235	6.9e-41	PFAM
low complexity region	274	283	N/A	INTRINSIC
internal_repeat_1	326	414	1.39e-5	PROSPERO
internal_repeat_1	439	527	1.39e-5	PROSPERO
low complexity region	649	664	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165566

SMART Domains

Protein: ENSMUSP00000126313
Gene: ENSMUSG00000040929

Domain	Start	End	E-Value	Type
Pfam:RFX1_trans_act	4	138	9.7e-38	PFAM
Pfam:RFX_DNA_binding	181	258	6.2e-36	PFAM
low complexity region	299	308	N/A	INTRINSIC
internal_repeat_1	351	439	1.82e-5	PROSPERO
internal_repeat_1	464	552	1.82e-5	PROSPERO
low complexity region	674	689	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172498

Predicted Effect

probably benign
Transcript: ENSMUST00000172907

SMART Domains

Protein: ENSMUSP00000134141
Gene: ENSMUSG00000040929

Domain	Start	End	E-Value	Type
Pfam:RFX1_trans_act	1	140	9.4e-58	PFAM
Pfam:RFX_DNA_binding	175	260	5.2e-41	PFAM
low complexity region	299	308	N/A	INTRINSIC
internal_repeat_1	351	439	1.82e-5	PROSPERO
internal_repeat_1	464	552	1.82e-5	PROSPERO
low complexity region	674	689	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173161

Predicted Effect

probably benign
Transcript: ENSMUST00000173863

SMART Domains

Protein: ENSMUSP00000133367
Gene: ENSMUSG00000040929

Domain	Start	End	E-Value	Type
Pfam:RFX1_trans_act	1	140	3.3e-58	PFAM
Pfam:RFX_DNA_binding	175	246	3.7e-24	PFAM
low complexity region	285	294	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174850

SMART Domains

Protein: ENSMUSP00000133461
Gene: ENSMUSG00000040929

Domain	Start	End	E-Value	Type
Pfam:RFX1_trans_act	1	140	9.4e-58	PFAM
Pfam:RFX_DNA_binding	175	260	5.2e-41	PFAM
low complexity region	299	308	N/A	INTRINSIC
internal_repeat_1	351	439	1.82e-5	PROSPERO
internal_repeat_1	464	552	1.82e-5	PROSPERO
low complexity region	674	689	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

98% (42/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X2, X4, and X5. It is a transcriptional activator that can bind DNA as a monomer or as a heterodimer with other RFX family members. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null mice display embryonic and perinatal lethality, impaired development of cilia on the embryonic node, abnormal left-right patterning, meso- and dextrocardia, and situs inversus in surviving adults. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1a	A	T	5: 8,686,164	I186F	probably benign	Het
Afg3l1	T	C	8: 123,494,939		probably benign	Het
Atg4a	G	A	X: 140,992,840	E106K	probably benign	Het
C130079G13Rik	G	A	3: 59,936,409	V175I	probably benign	Het
Ccdc50	A	G	16: 27,406,729	E64G	probably damaging	Het
Celsr3	G	T	9: 108,829,308	G997W	probably damaging	Het
Chd8	C	T	14: 52,204,495	E2138K	possibly damaging	Het
Col19a1	C	T	1: 24,559,681	G77E	unknown	Het
Fhad1	G	T	4: 141,904,968	Q1287K	probably benign	Het
Fzr1	G	T	10: 81,369,418	T159K	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Gna13	T	C	11: 109,363,125	I51T	probably damaging	Het
Gorab	A	G	1: 163,396,806		probably null	Het
Hydin	T	C	8: 110,519,114	V2153A	probably benign	Het
Ints6	A	G	14: 62,704,826	V486A	probably damaging	Het
Irx2	A	G	13: 72,631,590	K331R	probably damaging	Het
Lrrc6	A	G	15: 66,447,676		probably benign	Het
Mark2	T	C	19: 7,286,862	E116G	probably damaging	Het
Med14	A	T	X: 12,683,996	H684Q	probably benign	Het
Olfr384	A	T	11: 73,603,383	T268S	probably benign	Het
Pde5a	T	C	3: 122,851,708	L755P	probably damaging	Het
Pex14	A	T	4: 148,963,511	I203N	probably benign	Het
Pi4ka	T	C	16: 17,350,793	E691G	probably damaging	Het
Plekha1	G	T	7: 130,908,365	W280C	probably damaging	Het
Pnoc	A	T	14: 65,404,835	F160I	probably damaging	Het
Ppfia3	C	A	7: 45,356,428	R348L	probably damaging	Het
Ppil6	A	T	10: 41,501,693		probably benign	Het
Psmd13	C	A	7: 140,897,740		probably benign	Het
Psme4	T	C	11: 30,845,173		probably benign	Het
Rnase11	A	G	14: 51,049,770	L109S	probably damaging	Het
Rngtt	A	G	4: 33,368,678	T404A	probably benign	Het
Sbf1	A	G	15: 89,303,218		probably null	Het
Sema5b	A	G	16: 35,659,931	N656S	probably damaging	Het
Ssh3	T	C	19: 4,265,296	Y338C	probably damaging	Het
Tgfbr3l	A	G	8: 4,249,280	D49G	probably damaging	Het
Thbs1	C	T	2: 118,117,628	T423I	probably benign	Het
Ttc17	A	T	2: 94,376,074	Y243*	probably null	Het
Zbtb8os	A	T	4: 129,341,516	E54D	probably damaging	Het
Zfp648	A	T	1: 154,205,135	K347*	probably null	Het
Zfp84	T	G	7: 29,775,333		probably null	Het

Other mutations in Rfx3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00548:Rfx3	APN	19	27806186	critical splice donor site	probably null
IGL00588:Rfx3	APN	19	27826076	nonsense	probably null
IGL01408:Rfx3	APN	19	27768650	missense	probably benign	0.04
IGL01937:Rfx3	APN	19	27830729	missense	probably damaging	1.00
IGL02668:Rfx3	APN	19	27815614	splice site	probably benign
IGL02679:Rfx3	APN	19	27849737	missense	possibly damaging	0.95
R0267:Rfx3	UTSW	19	27793788	missense	probably benign	0.00
R0336:Rfx3	UTSW	19	27806262	missense	probably benign	0.00
R0838:Rfx3	UTSW	19	27849967	missense	possibly damaging	0.92
R0967:Rfx3	UTSW	19	27806351	splice site	probably benign
R1102:Rfx3	UTSW	19	27867600	missense	possibly damaging	0.51
R1507:Rfx3	UTSW	19	27768513	missense	probably benign	0.00
R2172:Rfx3	UTSW	19	27815494	nonsense	probably null
R2960:Rfx3	UTSW	19	27900811	nonsense	probably null
R4291:Rfx3	UTSW	19	27800232	missense	probably damaging	1.00
R4952:Rfx3	UTSW	19	27830672	missense	probably damaging	1.00
R5198:Rfx3	UTSW	19	27830776	missense	probably damaging	1.00
R5451:Rfx3	UTSW	19	27849959	missense	probably damaging	1.00
R5590:Rfx3	UTSW	19	27802380	critical splice donor site	probably null
R5641:Rfx3	UTSW	19	27793608	splice site	probably null
R5663:Rfx3	UTSW	19	27793617	missense	probably damaging	1.00
R5899:Rfx3	UTSW	19	27830765	missense	probably damaging	1.00
R6049:Rfx3	UTSW	19	27802395	missense	probably damaging	0.99
R6368:Rfx3	UTSW	19	27768609	missense	possibly damaging	0.92
R7131:Rfx3	UTSW	19	27768628	nonsense	probably null
R7273:Rfx3	UTSW	19	27802458	missense	probably damaging	1.00
R7593:Rfx3	UTSW	19	27849739	missense	probably benign	0.00
Z1088:Rfx3	UTSW	19	27837450	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAAATCACTAAGATGGGAGCCG -3'
(R):5'- GGAAGTATAGCCACCTTAGCAG -3'

Sequencing Primer
(F):5'- TGGGAGCCGCACATATTAAAATCTC -3'
(R):5'- AGCTTATGGTAAAGTAAAAGACCAG -3'

Posted On

2014-12-04