Incidental Mutation 'R2844:Med14'
ID251483
Institutional Source Beutler Lab
Gene Symbol Med14
Ensembl Gene ENSMUSG00000064127
Gene Namemediator complex subunit 14
SynonymsTrap170, LOC270579, Crsp2, ENSMUSG00000073278, ORF1, 9930001L01Rik
MMRRC Submission 040437-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R2844 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location12675369-12762073 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12683996 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 684 (H684Q)
Ref Sequence ENSEMBL: ENSMUSP00000111143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096495] [ENSMUST00000115481]
Predicted Effect probably benign
Transcript: ENSMUST00000096495
AA Change: H1323Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000094239
Gene: ENSMUSG00000064127
AA Change: H1323Q

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
Pfam:Med14 55 244 6.7e-63 PFAM
low complexity region 608 621 N/A INTRINSIC
low complexity region 1005 1018 N/A INTRINSIC
low complexity region 1065 1086 N/A INTRINSIC
low complexity region 1346 1361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115481
AA Change: H684Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000111143
Gene: ENSMUSG00000064127
AA Change: H684Q

DomainStartEndE-ValueType
low complexity region 366 379 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
low complexity region 707 722 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124053
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein contains a bipartite nuclear localization signal. This gene is known to escape chromosome X-inactivation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male chimeras hemizygous for a gene trapped allele appear normal at E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,686,164 I186F probably benign Het
Afg3l1 T C 8: 123,494,939 probably benign Het
Atg4a G A X: 140,992,840 E106K probably benign Het
C130079G13Rik G A 3: 59,936,409 V175I probably benign Het
Ccdc50 A G 16: 27,406,729 E64G probably damaging Het
Celsr3 G T 9: 108,829,308 G997W probably damaging Het
Chd8 C T 14: 52,204,495 E2138K possibly damaging Het
Col19a1 C T 1: 24,559,681 G77E unknown Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Fzr1 G T 10: 81,369,418 T159K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gna13 T C 11: 109,363,125 I51T probably damaging Het
Gorab A G 1: 163,396,806 probably null Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Ints6 A G 14: 62,704,826 V486A probably damaging Het
Irx2 A G 13: 72,631,590 K331R probably damaging Het
Lrrc6 A G 15: 66,447,676 probably benign Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Olfr384 A T 11: 73,603,383 T268S probably benign Het
Pde5a T C 3: 122,851,708 L755P probably damaging Het
Pex14 A T 4: 148,963,511 I203N probably benign Het
Pi4ka T C 16: 17,350,793 E691G probably damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Pnoc A T 14: 65,404,835 F160I probably damaging Het
Ppfia3 C A 7: 45,356,428 R348L probably damaging Het
Ppil6 A T 10: 41,501,693 probably benign Het
Psmd13 C A 7: 140,897,740 probably benign Het
Psme4 T C 11: 30,845,173 probably benign Het
Rfx3 T C 19: 27,806,786 probably benign Het
Rnase11 A G 14: 51,049,770 L109S probably damaging Het
Rngtt A G 4: 33,368,678 T404A probably benign Het
Sbf1 A G 15: 89,303,218 probably null Het
Sema5b A G 16: 35,659,931 N656S probably damaging Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Thbs1 C T 2: 118,117,628 T423I probably benign Het
Ttc17 A T 2: 94,376,074 Y243* probably null Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zfp648 A T 1: 154,205,135 K347* probably null Het
Zfp84 T G 7: 29,775,333 probably null Het
Other mutations in Med14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Med14 APN X 12746764 splice site probably benign
IGL00670:Med14 APN X 12754189 missense probably damaging 0.98
IGL00895:Med14 APN X 12680800 missense probably damaging 0.99
IGL02434:Med14 APN X 12745824 missense possibly damaging 0.89
IGL03064:Med14 APN X 12747503 missense probably benign 0.04
R0295:Med14 UTSW X 12685748 missense probably damaging 1.00
R2860:Med14 UTSW X 12719697 missense probably benign
R2861:Med14 UTSW X 12719697 missense probably benign
R2862:Med14 UTSW X 12719697 missense probably benign
R3157:Med14 UTSW X 12684091 splice site probably benign
R3158:Med14 UTSW X 12684091 splice site probably benign
R3807:Med14 UTSW X 12687177 missense probably damaging 1.00
X0022:Med14 UTSW X 12687141 missense probably damaging 1.00
Z1088:Med14 UTSW X 12677606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTTGCTGAGAATGGCTG -3'
(R):5'- CCGATGAGCTTCAAGTTTTGGAG -3'

Sequencing Primer
(F):5'- TTTAACTCCCCACTTAGAGGCTAGAG -3'
(R):5'- CTTCGAAACAAGAGTATGTGTTTCC -3'
Posted On2014-12-04