Incidental Mutation 'R2845:Zbtb8os'
ID251504
Institutional Source Beutler Lab
Gene Symbol Zbtb8os
Ensembl Gene ENSMUSG00000057572
Gene Namezinc finger and BTB domain containing 8 opposite strand
SynonymsArch, 2010001H09Rik, 2310028N13Rik
MMRRC Submission 040438-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R2845 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location129335695-129354547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129341516 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 54 (E54D)
Ref Sequence ENSEMBL: ENSMUSP00000113004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119480] [ENSMUST00000141235] [ENSMUST00000146767]
Predicted Effect unknown
Transcript: ENSMUST00000106047
AA Change: N44I
Predicted Effect probably damaging
Transcript: ENSMUST00000119480
AA Change: E54D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113004
Gene: ENSMUSG00000057572
AA Change: E54D

DomainStartEndE-ValueType
Pfam:Archease 31 119 4.6e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140272
Predicted Effect probably damaging
Transcript: ENSMUST00000141235
AA Change: E54D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120925
Gene: ENSMUSG00000057572
AA Change: E54D

DomainStartEndE-ValueType
Pfam:Archease 31 167 3.3e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146767
AA Change: E54D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114628
Gene: ENSMUSG00000057572
AA Change: E54D

DomainStartEndE-ValueType
Pfam:Archease 31 145 3.5e-40 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,216,380 R1412H probably damaging Het
Arhgap25 C T 6: 87,459,967 E634K possibly damaging Het
Atg4a G A X: 140,992,840 E106K probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Cep152 A G 2: 125,587,974 I676T probably damaging Het
Cherp C A 8: 72,466,403 A449S probably damaging Het
Col19a1 C T 1: 24,559,681 G77E unknown Het
Csnk1g2 A G 10: 80,638,604 S220G probably damaging Het
Efcab7 T A 4: 99,909,638 V20D probably damaging Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Frem3 T C 8: 80,613,220 F714S probably damaging Het
Gm13088 G A 4: 143,654,298 S385F probably damaging Het
Gpx6 A T 13: 21,318,875 probably null Het
Hsd3b1 T C 3: 98,852,778 E299G probably damaging Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Mrgpra2a T A 7: 47,427,130 M127L probably benign Het
Olfr119 T C 17: 37,700,823 I51T probably damaging Het
Pign C A 1: 105,657,796 L9F possibly damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Plekhh3 T C 11: 101,170,230 probably benign Het
Psmd13 C A 7: 140,897,740 probably benign Het
Ptpru T A 4: 131,819,661 I168F probably benign Het
Sbf1 A G 15: 89,303,218 probably null Het
Skint10 T C 4: 112,715,826 S258G probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
Tas2r138 T C 6: 40,612,767 S182G probably benign Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Zfp24 G T 18: 24,017,828 T87K probably damaging Het
Zfp407 G T 18: 84,558,397 C1530* probably null Het
Other mutations in Zbtb8os
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0597:Zbtb8os UTSW 4 129346877 missense probably damaging 1.00
R2843:Zbtb8os UTSW 4 129341516 missense probably damaging 0.99
R2844:Zbtb8os UTSW 4 129341516 missense probably damaging 0.99
R2846:Zbtb8os UTSW 4 129341516 missense probably damaging 0.99
R4132:Zbtb8os UTSW 4 129336113 missense probably damaging 1.00
R4714:Zbtb8os UTSW 4 129341764 missense probably damaging 0.98
R5138:Zbtb8os UTSW 4 129346926 intron probably benign
R5579:Zbtb8os UTSW 4 129340735 missense probably damaging 0.99
R6019:Zbtb8os UTSW 4 129340749 missense possibly damaging 0.93
R6265:Zbtb8os UTSW 4 129335982 start gained probably benign
R6365:Zbtb8os UTSW 4 129343152 missense possibly damaging 0.89
Z1176:Zbtb8os UTSW 4 129341521 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GGGTGTCGTCAAATTAGACATGTAG -3'
(R):5'- TCCCCTACAGAGTGGAAAGGAC -3'

Sequencing Primer
(F):5'- CACATACTGTGGCCTCTT -3'
(R):5'- GTTCAGAATCCACCCTGAGG -3'
Posted On2014-12-04