Incidental Mutation 'R2845:Cherp'
ID 251525
Institutional Source Beutler Lab
Gene Symbol Cherp
Ensembl Gene ENSMUSG00000052488
Gene Name calcium homeostasis endoplasmic reticulum protein
Synonyms DAN16, SCAF6, D8Wsu96e, 5730408I11Rik
MMRRC Submission 040438-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.964) question?
Stock # R2845 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 73214333-73229070 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 73220247 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 449 (A449S)
Ref Sequence ENSEMBL: ENSMUSP00000078469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079510] [ENSMUST00000212991]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000079510
AA Change: A449S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078469
Gene: ENSMUSG00000052488
AA Change: A449S

DomainStartEndE-ValueType
SWAP 13 65 9.76e-24 SMART
low complexity region 78 100 N/A INTRINSIC
low complexity region 107 124 N/A INTRINSIC
RPR 156 286 5.32e-2 SMART
coiled coil region 310 334 N/A INTRINSIC
low complexity region 362 385 N/A INTRINSIC
low complexity region 409 419 N/A INTRINSIC
low complexity region 439 463 N/A INTRINSIC
low complexity region 488 500 N/A INTRINSIC
low complexity region 526 560 N/A INTRINSIC
low complexity region 565 580 N/A INTRINSIC
low complexity region 591 606 N/A INTRINSIC
low complexity region 725 736 N/A INTRINSIC
low complexity region 743 829 N/A INTRINSIC
G_patch 850 900 9.8e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212870
Predicted Effect possibly damaging
Transcript: ENSMUST00000212991
AA Change: A438S

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap25 C T 6: 87,436,949 (GRCm39) E634K possibly damaging Het
Atg4a G A X: 139,893,589 (GRCm39) E106K probably benign Het
Bahd1 G A 2: 118,753,004 (GRCm39) R757H probably damaging Het
Cep152 A G 2: 125,429,894 (GRCm39) I676T probably damaging Het
Col19a1 C T 1: 24,598,762 (GRCm39) G77E unknown Het
Cplane1 G A 15: 8,245,864 (GRCm39) R1412H probably damaging Het
Csnk1g2 A G 10: 80,474,438 (GRCm39) S220G probably damaging Het
Efcab7 T A 4: 99,766,835 (GRCm39) V20D probably damaging Het
Fhad1 G T 4: 141,632,279 (GRCm39) Q1287K probably benign Het
Frem3 T C 8: 81,339,849 (GRCm39) F714S probably damaging Het
Gpx6 A T 13: 21,503,045 (GRCm39) probably null Het
Hsd3b1 T C 3: 98,760,094 (GRCm39) E299G probably damaging Het
Mark2 T C 19: 7,264,227 (GRCm39) E116G probably damaging Het
Mrgpra2a T A 7: 47,076,878 (GRCm39) M127L probably benign Het
Or10al3 T C 17: 38,011,714 (GRCm39) I51T probably damaging Het
Pign C A 1: 105,585,521 (GRCm39) L9F possibly damaging Het
Plekha1 G T 7: 130,510,095 (GRCm39) W280C probably damaging Het
Plekhh3 T C 11: 101,061,056 (GRCm39) probably benign Het
Pramel22 G A 4: 143,380,868 (GRCm39) S385F probably damaging Het
Psmd13 C A 7: 140,477,653 (GRCm39) probably benign Het
Ptpru T A 4: 131,546,972 (GRCm39) I168F probably benign Het
Sbf1 A G 15: 89,187,421 (GRCm39) probably null Het
Skint10 T C 4: 112,573,023 (GRCm39) S258G probably benign Het
Slc15a4 A G 5: 127,681,600 (GRCm39) probably null Het
Ssh3 T C 19: 4,315,324 (GRCm39) Y338C probably damaging Het
Tas2r138 T C 6: 40,589,701 (GRCm39) S182G probably benign Het
Tgfbr3l A G 8: 4,299,280 (GRCm39) D49G probably damaging Het
Zbtb8os A T 4: 129,235,309 (GRCm39) E54D probably damaging Het
Zfp24 G T 18: 24,150,885 (GRCm39) T87K probably damaging Het
Zfp407 G T 18: 84,576,522 (GRCm39) C1530* probably null Het
Other mutations in Cherp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Cherp APN 8 73,222,090 (GRCm39) missense probably damaging 0.97
IGL00955:Cherp APN 8 73,224,038 (GRCm39) missense probably damaging 0.99
R0452:Cherp UTSW 8 73,215,366 (GRCm39) unclassified probably benign
R0479:Cherp UTSW 8 73,216,991 (GRCm39) missense possibly damaging 0.66
R0594:Cherp UTSW 8 73,216,246 (GRCm39) critical splice donor site probably null
R1734:Cherp UTSW 8 73,223,932 (GRCm39) critical splice donor site probably null
R1781:Cherp UTSW 8 73,221,615 (GRCm39) missense probably damaging 1.00
R1793:Cherp UTSW 8 73,216,994 (GRCm39) missense probably benign 0.12
R2012:Cherp UTSW 8 73,228,613 (GRCm39) missense probably damaging 0.98
R3612:Cherp UTSW 8 73,215,840 (GRCm39) unclassified probably benign
R3693:Cherp UTSW 8 73,221,755 (GRCm39) small deletion probably benign
R3899:Cherp UTSW 8 73,223,780 (GRCm39) missense possibly damaging 0.63
R3900:Cherp UTSW 8 73,223,780 (GRCm39) missense possibly damaging 0.63
R3970:Cherp UTSW 8 73,223,795 (GRCm39) missense possibly damaging 0.60
R4915:Cherp UTSW 8 73,222,241 (GRCm39) missense probably damaging 1.00
R5512:Cherp UTSW 8 73,217,110 (GRCm39) missense possibly damaging 0.66
R5556:Cherp UTSW 8 73,221,824 (GRCm39) missense probably damaging 0.99
R5739:Cherp UTSW 8 73,221,659 (GRCm39) small deletion probably benign
R5768:Cherp UTSW 8 73,216,957 (GRCm39) missense probably damaging 0.98
R5824:Cherp UTSW 8 73,216,102 (GRCm39) unclassified probably benign
R5963:Cherp UTSW 8 73,215,379 (GRCm39) unclassified probably benign
R6255:Cherp UTSW 8 73,224,725 (GRCm39) missense probably damaging 0.99
R7145:Cherp UTSW 8 73,222,230 (GRCm39) missense
R7538:Cherp UTSW 8 73,216,263 (GRCm39) missense
R7578:Cherp UTSW 8 73,218,102 (GRCm39) missense
R8329:Cherp UTSW 8 73,215,852 (GRCm39) missense
R9717:Cherp UTSW 8 73,216,920 (GRCm39) critical splice donor site probably null
RF001:Cherp UTSW 8 73,215,893 (GRCm39) frame shift probably null
RF007:Cherp UTSW 8 73,215,903 (GRCm39) small deletion probably benign
RF036:Cherp UTSW 8 73,215,891 (GRCm39) frame shift probably null
RF036:Cherp UTSW 8 73,215,888 (GRCm39) frame shift probably null
RF059:Cherp UTSW 8 73,215,899 (GRCm39) frame shift probably null
T0722:Cherp UTSW 8 73,215,878 (GRCm39) small deletion probably benign
T0975:Cherp UTSW 8 73,215,878 (GRCm39) small deletion probably benign
Z1176:Cherp UTSW 8 73,224,797 (GRCm39) missense
Z1177:Cherp UTSW 8 73,228,979 (GRCm39) start gained probably benign
Z1177:Cherp UTSW 8 73,216,760 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TCATTAGGTGCAAGCAGCCC -3'
(R):5'- TGTCACCTGTGTTAGATGACAAC -3'

Sequencing Primer
(F):5'- GTCCTGGAACTCGGATCTATAGAC -3'
(R):5'- CTGTGTTAGATGACAACAAGCCTC -3'
Posted On 2014-12-04