Incidental Mutation 'R2508:Ucp2'
ID251526
Institutional Source Beutler Lab
Gene Symbol Ucp2
Ensembl Gene ENSMUSG00000033685
Gene Nameuncoupling protein 2 (mitochondrial, proton carrier)
Synonyms
MMRRC Submission 040414-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R2508 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location100493337-100502020 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100498413 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 200 (I200F)
Ref Sequence ENSEMBL: ENSMUSP00000146337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126534] [ENSMUST00000129324] [ENSMUST00000133044] [ENSMUST00000153287] [ENSMUST00000154516] [ENSMUST00000207405] [ENSMUST00000207748]
Predicted Effect probably benign
Transcript: ENSMUST00000054923
SMART Domains Protein: ENSMUSP00000059074
Gene: ENSMUSG00000030708

DomainStartEndE-ValueType
DnaJ 3 60 3.52e-23 SMART
Pfam:DnaJ_C 140 299 1.3e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126381
Predicted Effect probably benign
Transcript: ENSMUST00000126534
AA Change: I200F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120967
Gene: ENSMUSG00000033685
AA Change: I200F

DomainStartEndE-ValueType
Pfam:Mito_carr 10 111 1.3e-21 PFAM
Pfam:Mito_carr 112 208 2e-27 PFAM
Pfam:Mito_carr 211 302 5.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129324
SMART Domains Protein: ENSMUSP00000115648
Gene: ENSMUSG00000033685

DomainStartEndE-ValueType
Pfam:Mito_carr 9 65 8.7e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130534
Predicted Effect probably benign
Transcript: ENSMUST00000133044
SMART Domains Protein: ENSMUSP00000115598
Gene: ENSMUSG00000033685

DomainStartEndE-ValueType
Pfam:Mito_carr 9 111 2.6e-23 PFAM
Pfam:Mito_carr 112 172 1.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151221
Predicted Effect probably benign
Transcript: ENSMUST00000153287
SMART Domains Protein: ENSMUSP00000115953
Gene: ENSMUSG00000033685

DomainStartEndE-ValueType
Pfam:Mito_carr 9 111 6.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154516
Predicted Effect probably benign
Transcript: ENSMUST00000207405
Predicted Effect probably benign
Transcript: ENSMUST00000207748
AA Change: I200F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207890
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed in many tissues, with the greatest expression in skeletal muscle. It is thought to play a role in nonshivering thermogenesis, obesity and diabetes. Chromosomal order is 5'-UCP3-UCP2-3'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have elevated pancreatic islet cell ATP levels and increased glucose-stimulated secretion of insulin. Homozygotes also show reduced mitochondrial proton leak in thymocytes and increased resistance to infection by Toxoplasma gondii. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik C T 8: 120,145,393 T20I probably benign Het
Adamts2 C T 11: 50,788,689 T832I possibly damaging Het
Agbl1 G A 7: 76,589,550 probably null Het
Ankrd61 T C 5: 143,897,076 probably benign Het
Anpep T G 7: 79,838,291 Y506S possibly damaging Het
Aox2 T A 1: 58,343,673 H1037Q probably benign Het
Auh G A 13: 52,898,719 R47* probably null Het
B4galt5 T A 2: 167,306,638 M187L probably benign Het
Bub1 A T 2: 127,801,423 D1000E probably benign Het
Cacna1f T G X: 7,626,448 probably null Het
Cdh3 T C 8: 106,552,407 L667P probably damaging Het
Cenpe A T 3: 135,241,073 R1116S possibly damaging Het
Ces1b T A 8: 93,073,341 M136L possibly damaging Het
Cfap54 T C 10: 92,997,374 E1130G possibly damaging Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clu T C 14: 65,975,003 V135A probably damaging Het
Cmip T A 8: 117,436,693 S388T probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cox4i1 T A 8: 120,673,290 V51E possibly damaging Het
Crym T C 7: 120,201,827 N33S probably benign Het
Ctcf T A 8: 105,671,384 V434E probably damaging Het
D430042O09Rik T A 7: 125,795,343 V197D probably benign Het
Daam1 G A 12: 71,975,223 D732N probably damaging Het
Dcaf13 A G 15: 39,145,152 Y383C probably benign Het
Dock2 T C 11: 34,312,485 T957A probably benign Het
Duox1 A G 2: 122,333,138 D817G probably benign Het
Fads3 A G 19: 10,056,454 Y401C probably damaging Het
Fam72a T C 1: 131,528,854 probably null Het
Fbxw21 C A 9: 109,145,485 K322N probably benign Het
Fdxr G A 11: 115,271,980 T100I probably damaging Het
Galnt11 C G 5: 25,247,612 P41A probably damaging Het
Glb1l T C 1: 75,201,829 T322A probably damaging Het
Gm6803 T C 12: 88,018,488 Y95C probably damaging Het
Gm6871 T A 7: 41,547,990 T149S probably benign Het
Gpr26 C T 7: 131,967,094 T56I probably damaging Het
Grik4 C A 9: 42,622,142 G361C probably damaging Het
Gsr T G 8: 33,680,288 D200E probably benign Het
Igsf5 T A 16: 96,364,047 D7E probably benign Het
Inpp5e T A 2: 26,399,343 I522F probably damaging Het
Insm2 C A 12: 55,600,311 T280K probably benign Het
Itih4 T C 14: 30,895,478 V585A probably damaging Het
Knl1 A T 2: 119,058,368 R17* probably null Het
Lag3 G T 6: 124,911,309 L15I possibly damaging Het
Lepr T A 4: 101,790,896 S861T probably damaging Het
Mcur1 A T 13: 43,544,465 Y320N probably damaging Het
Mgam A T 6: 40,759,783 D872V probably damaging Het
Mlycd T C 8: 119,407,707 probably null Het
Mpl C A 4: 118,455,757 C193F probably damaging Het
Mycbp2 C A 14: 103,131,245 A4142S probably damaging Het
Myh1 T A 11: 67,213,598 D993E possibly damaging Het
N4bp2 T A 5: 65,790,061 D11E probably benign Het
Neb T C 2: 52,195,521 I1521V probably benign Het
Notch1 A G 2: 26,465,473 V1744A possibly damaging Het
Numa1 T C 7: 101,995,524 S236P possibly damaging Het
Olfr1056 A G 2: 86,356,364 L6P possibly damaging Het
Olfr1181 T C 2: 88,423,456 T190A possibly damaging Het
Olfr798 T A 10: 129,625,915 I49L probably benign Het
Otogl A G 10: 107,874,500 L576P probably damaging Het
P2ry1 C T 3: 61,003,479 T13M probably damaging Het
Pak6 A T 2: 118,694,569 R559* probably null Het
Papd4 A G 13: 93,184,218 L109S probably damaging Het
Parvb A T 15: 84,297,970 M234L probably benign Het
Pcdha11 T C 18: 37,012,854 V666A possibly damaging Het
Pde3b T A 7: 114,526,857 Y775* probably null Het
Pgam5 A G 5: 110,266,003 L98P probably damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Pkib T G 10: 57,728,109 D4E probably damaging Het
Plcb1 A T 2: 135,260,508 I202F probably benign Het
Pold3 A G 7: 100,121,383 V14A probably damaging Het
Prdm1 T A 10: 44,446,807 T249S probably benign Het
Prpf39 T A 12: 65,057,815 F551L probably benign Het
Prune2 A G 19: 17,122,622 E1830G probably benign Het
Ralgapa1 G A 12: 55,718,201 P889S probably damaging Het
Rassf2 A T 2: 131,998,243 probably null Het
Rnf185 A G 11: 3,418,067 Y204H probably benign Het
Rpap1 A G 2: 119,780,054 probably null Het
Rufy3 T C 5: 88,649,898 S645P probably damaging Het
Scn11a T A 9: 119,765,529 Y1266F probably damaging Het
Senp7 T A 16: 56,151,362 H287Q probably benign Het
Sgsm3 T C 15: 81,003,872 probably null Het
Slc25a11 A T 11: 70,645,832 V104E possibly damaging Het
Slc25a13 G A 6: 6,117,190 T175I probably benign Het
Slc26a3 T A 12: 31,470,903 F702Y probably damaging Het
Smco2 T A 6: 146,859,967 L184H probably damaging Het
Ssc4d A T 5: 135,965,607 C90S probably damaging Het
Sspo T C 6: 48,464,364 S1835P probably damaging Het
Stk35 A G 2: 129,801,515 T140A probably damaging Het
Syngr1 C T 15: 80,111,740 T160M probably damaging Het
Tgfb1i1 A G 7: 128,248,913 probably null Het
Thoc1 T A 18: 9,977,947 V296E probably damaging Het
Timp2 C T 11: 118,310,586 C75Y probably damaging Het
Tlr1 T C 5: 64,925,296 Y646C probably damaging Het
Tprn G A 2: 25,268,928 E655K possibly damaging Het
Trbv14 A C 6: 41,135,490 I74L probably benign Het
Trbv5 T A 6: 41,062,621 Y53* probably null Het
Trpm5 T C 7: 143,088,919 Q97R possibly damaging Het
Tut1 A G 19: 8,955,567 D88G probably damaging Het
Unc45a G A 7: 80,338,875 S131L probably benign Het
Uty A T Y: 1,158,182 H573Q probably damaging Het
Vmn1r17 T A 6: 57,360,870 Y121F possibly damaging Het
Vmn1r53 T C 6: 90,223,572 I257V probably benign Het
Vmn2r90 C T 17: 17,733,967 L798F probably damaging Het
Vmn2r94 A T 17: 18,257,474 M225K probably benign Het
Wdr24 A T 17: 25,824,299 I32F possibly damaging Het
Zc3h11a T A 1: 133,624,783 T529S probably benign Het
Zc3h4 A G 7: 16,434,339 H791R unknown Het
Zfp24 A G 18: 24,017,870 L73P probably damaging Het
Zfp616 T C 11: 74,083,295 I130T probably benign Het
Zim1 ACAGCAG ACAGCAGCAG 7: 6,677,430 probably benign Het
Zim1 CAG CAGAAG 7: 6,677,431 probably benign Het
Other mutations in Ucp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Ucp2 APN 7 100498422 missense probably benign
IGL02184:Ucp2 APN 7 100499322 missense probably benign
IGL02370:Ucp2 APN 7 100498384 missense probably damaging 0.96
IGL02449:Ucp2 APN 7 100498810 missense probably damaging 1.00
R1808:Ucp2 UTSW 7 100498814 missense probably damaging 0.97
R1809:Ucp2 UTSW 7 100498399 missense probably damaging 0.98
R2384:Ucp2 UTSW 7 100498254 missense probably benign
R2866:Ucp2 UTSW 7 100497252 missense probably benign 0.31
R4400:Ucp2 UTSW 7 100499350 makesense probably null
R5022:Ucp2 UTSW 7 100498372 missense possibly damaging 0.74
R6073:Ucp2 UTSW 7 100498131 missense possibly damaging 0.96
R6530:Ucp2 UTSW 7 100498223 missense probably benign
R7381:Ucp2 UTSW 7 100498369 missense possibly damaging 0.94
R7572:Ucp2 UTSW 7 100497307 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGAGATACCAGAGCACTGTC -3'
(R):5'- CGCCTGTTTATGTGCAAAGTGG -3'

Sequencing Primer
(F):5'- TGTCGAAGCCTACAAGACCATTG -3'
(R):5'- ATGTGCAAAGTGGGGTTTTTACC -3'
Posted On2014-12-04