Incidental Mutation 'R2508:Crym'
ID251531
Institutional Source Beutler Lab
Gene Symbol Crym
Ensembl Gene ENSMUSG00000030905
Gene Namecrystallin, mu
Synonyms
MMRRC Submission 040414-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2508 (G1)
Quality Score193
Status Not validated
Chromosome7
Chromosomal Location120186380-120202111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120201827 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 33 (N33S)
Ref Sequence ENSEMBL: ENSMUSP00000033198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033198] [ENSMUST00000084640]
PDB Structure
Crystal structure of the apo form of mouse Mu-crystallin. [X-RAY DIFFRACTION]
Crystal structure of the NADPH form of mouse Mu-crystallin. [X-RAY DIFFRACTION]
Cristal structure of the NADPH-T3 form of mouse Mu-crystallin. [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000033198
AA Change: N33S

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000033198
Gene: ENSMUSG00000030905
AA Change: N33S

DomainStartEndE-ValueType
Pfam:OCD_Mu_crystall 3 313 7.1e-113 PFAM
Pfam:Shikimate_DH 124 227 7.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084640
SMART Domains Protein: ENSMUSP00000081690
Gene: ENSMUSG00000062017

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 463 5.7e-23 PFAM
AAA 548 729 1.59e-10 SMART
Pfam:ABC2_membrane_3 902 1296 1.2e-36 PFAM
AAA 1384 1568 1.33e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143257
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Crystallins are separated into two classes: taxon-specific and ubiquitous. The former class is also called phylogenetically-restricted crystallins. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. This gene encodes a taxon-specific crystallin protein that binds NADPH and has sequence similarity to bacterial ornithine cyclodeaminases. The encoded protein does not perform a structural role in lens tissue, and instead it binds thyroid hormone for possible regulatory or developmental roles. Mutations in this gene have been associated with autosomal dominant non-syndromic deafness. [provided by RefSeq, Sep 2014]
PHENOTYPE: At the euthyroid state, homozygotes display a normal growth curve, heart rate and hearing ability but have significantly reduced serum concentrations of triiodothyronine (T3) and thyroxine (T4). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik C T 8: 120,145,393 T20I probably benign Het
Adamts2 C T 11: 50,788,689 T832I possibly damaging Het
Agbl1 G A 7: 76,589,550 probably null Het
Ankrd61 T C 5: 143,897,076 probably benign Het
Anpep T G 7: 79,838,291 Y506S possibly damaging Het
Aox2 T A 1: 58,343,673 H1037Q probably benign Het
Auh G A 13: 52,898,719 R47* probably null Het
B4galt5 T A 2: 167,306,638 M187L probably benign Het
Bub1 A T 2: 127,801,423 D1000E probably benign Het
Cacna1f T G X: 7,626,448 probably null Het
Cdh3 T C 8: 106,552,407 L667P probably damaging Het
Cenpe A T 3: 135,241,073 R1116S possibly damaging Het
Ces1b T A 8: 93,073,341 M136L possibly damaging Het
Cfap54 T C 10: 92,997,374 E1130G possibly damaging Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clu T C 14: 65,975,003 V135A probably damaging Het
Cmip T A 8: 117,436,693 S388T probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cox4i1 T A 8: 120,673,290 V51E possibly damaging Het
Ctcf T A 8: 105,671,384 V434E probably damaging Het
D430042O09Rik T A 7: 125,795,343 V197D probably benign Het
Daam1 G A 12: 71,975,223 D732N probably damaging Het
Dcaf13 A G 15: 39,145,152 Y383C probably benign Het
Dock2 T C 11: 34,312,485 T957A probably benign Het
Duox1 A G 2: 122,333,138 D817G probably benign Het
Fads3 A G 19: 10,056,454 Y401C probably damaging Het
Fam72a T C 1: 131,528,854 probably null Het
Fbxw21 C A 9: 109,145,485 K322N probably benign Het
Fdxr G A 11: 115,271,980 T100I probably damaging Het
Galnt11 C G 5: 25,247,612 P41A probably damaging Het
Glb1l T C 1: 75,201,829 T322A probably damaging Het
Gm6803 T C 12: 88,018,488 Y95C probably damaging Het
Gm6871 T A 7: 41,547,990 T149S probably benign Het
Gpr26 C T 7: 131,967,094 T56I probably damaging Het
Grik4 C A 9: 42,622,142 G361C probably damaging Het
Gsr T G 8: 33,680,288 D200E probably benign Het
Igsf5 T A 16: 96,364,047 D7E probably benign Het
Inpp5e T A 2: 26,399,343 I522F probably damaging Het
Insm2 C A 12: 55,600,311 T280K probably benign Het
Itih4 T C 14: 30,895,478 V585A probably damaging Het
Knl1 A T 2: 119,058,368 R17* probably null Het
Lag3 G T 6: 124,911,309 L15I possibly damaging Het
Lepr T A 4: 101,790,896 S861T probably damaging Het
Mcur1 A T 13: 43,544,465 Y320N probably damaging Het
Mgam A T 6: 40,759,783 D872V probably damaging Het
Mlycd T C 8: 119,407,707 probably null Het
Mpl C A 4: 118,455,757 C193F probably damaging Het
Mycbp2 C A 14: 103,131,245 A4142S probably damaging Het
Myh1 T A 11: 67,213,598 D993E possibly damaging Het
N4bp2 T A 5: 65,790,061 D11E probably benign Het
Neb T C 2: 52,195,521 I1521V probably benign Het
Notch1 A G 2: 26,465,473 V1744A possibly damaging Het
Numa1 T C 7: 101,995,524 S236P possibly damaging Het
Olfr1056 A G 2: 86,356,364 L6P possibly damaging Het
Olfr1181 T C 2: 88,423,456 T190A possibly damaging Het
Olfr798 T A 10: 129,625,915 I49L probably benign Het
Otogl A G 10: 107,874,500 L576P probably damaging Het
P2ry1 C T 3: 61,003,479 T13M probably damaging Het
Pak6 A T 2: 118,694,569 R559* probably null Het
Papd4 A G 13: 93,184,218 L109S probably damaging Het
Parvb A T 15: 84,297,970 M234L probably benign Het
Pcdha11 T C 18: 37,012,854 V666A possibly damaging Het
Pde3b T A 7: 114,526,857 Y775* probably null Het
Pgam5 A G 5: 110,266,003 L98P probably damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Pkib T G 10: 57,728,109 D4E probably damaging Het
Plcb1 A T 2: 135,260,508 I202F probably benign Het
Pold3 A G 7: 100,121,383 V14A probably damaging Het
Prdm1 T A 10: 44,446,807 T249S probably benign Het
Prpf39 T A 12: 65,057,815 F551L probably benign Het
Prune2 A G 19: 17,122,622 E1830G probably benign Het
Ralgapa1 G A 12: 55,718,201 P889S probably damaging Het
Rassf2 A T 2: 131,998,243 probably null Het
Rnf185 A G 11: 3,418,067 Y204H probably benign Het
Rpap1 A G 2: 119,780,054 probably null Het
Rufy3 T C 5: 88,649,898 S645P probably damaging Het
Scn11a T A 9: 119,765,529 Y1266F probably damaging Het
Senp7 T A 16: 56,151,362 H287Q probably benign Het
Sgsm3 T C 15: 81,003,872 probably null Het
Slc25a11 A T 11: 70,645,832 V104E possibly damaging Het
Slc25a13 G A 6: 6,117,190 T175I probably benign Het
Slc26a3 T A 12: 31,470,903 F702Y probably damaging Het
Smco2 T A 6: 146,859,967 L184H probably damaging Het
Ssc4d A T 5: 135,965,607 C90S probably damaging Het
Sspo T C 6: 48,464,364 S1835P probably damaging Het
Stk35 A G 2: 129,801,515 T140A probably damaging Het
Syngr1 C T 15: 80,111,740 T160M probably damaging Het
Tgfb1i1 A G 7: 128,248,913 probably null Het
Thoc1 T A 18: 9,977,947 V296E probably damaging Het
Timp2 C T 11: 118,310,586 C75Y probably damaging Het
Tlr1 T C 5: 64,925,296 Y646C probably damaging Het
Tprn G A 2: 25,268,928 E655K possibly damaging Het
Trbv14 A C 6: 41,135,490 I74L probably benign Het
Trbv5 T A 6: 41,062,621 Y53* probably null Het
Trpm5 T C 7: 143,088,919 Q97R possibly damaging Het
Tut1 A G 19: 8,955,567 D88G probably damaging Het
Ucp2 A T 7: 100,498,413 I200F probably benign Het
Unc45a G A 7: 80,338,875 S131L probably benign Het
Uty A T Y: 1,158,182 H573Q probably damaging Het
Vmn1r17 T A 6: 57,360,870 Y121F possibly damaging Het
Vmn1r53 T C 6: 90,223,572 I257V probably benign Het
Vmn2r90 C T 17: 17,733,967 L798F probably damaging Het
Vmn2r94 A T 17: 18,257,474 M225K probably benign Het
Wdr24 A T 17: 25,824,299 I32F possibly damaging Het
Zc3h11a T A 1: 133,624,783 T529S probably benign Het
Zc3h4 A G 7: 16,434,339 H791R unknown Het
Zfp24 A G 18: 24,017,870 L73P probably damaging Het
Zfp616 T C 11: 74,083,295 I130T probably benign Het
Zim1 ACAGCAG ACAGCAGCAG 7: 6,677,430 probably benign Het
Zim1 CAG CAGAAG 7: 6,677,431 probably benign Het
Other mutations in Crym
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01562:Crym APN 7 120195399 missense probably damaging 0.98
IGL03355:Crym APN 7 120199313 splice site probably null
R0393:Crym UTSW 7 120189749 missense probably benign 0.00
R1538:Crym UTSW 7 120197715 missense probably benign 0.05
R3836:Crym UTSW 7 120201216 missense probably benign 0.03
R4328:Crym UTSW 7 120195339 missense probably damaging 1.00
R4723:Crym UTSW 7 120201075 critical splice donor site probably null
R5046:Crym UTSW 7 120195444 missense possibly damaging 0.71
R5122:Crym UTSW 7 120195495 missense probably benign 0.00
R5266:Crym UTSW 7 120199294 missense probably benign 0.00
R5427:Crym UTSW 7 120199222 unclassified probably benign
R5567:Crym UTSW 7 120201893 missense probably benign 0.00
R5570:Crym UTSW 7 120201893 missense probably benign 0.00
R5704:Crym UTSW 7 120201940 splice site probably null
R6835:Crym UTSW 7 120186645 missense probably benign
R7274:Crym UTSW 7 120190519 missense probably benign 0.03
R7536:Crym UTSW 7 120201108 missense probably damaging 1.00
R8062:Crym UTSW 7 120201168 missense probably damaging 1.00
R8281:Crym UTSW 7 120202027 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CGCTTTCTTGGTAGAAGCCC -3'
(R):5'- AGTCCGCTCATTTAGGGCTC -3'

Sequencing Primer
(F):5'- GTTAGTGCCCCTTAAGTAGCAGC -3'
(R):5'- ATTTAGGGCTCAGCTCCTGGAAC -3'
Posted On2014-12-04