Mutagenetix > Incidental Mutation

Incidental Mutation 'R2845:2410089E03Rik'

251541

Institutional Source

Beutler Lab

Gene Symbol

2410089E03Rik

Ensembl Gene

ENSMUSG00000039801

Gene Name

RIKEN cDNA 2410089E03 gene

Synonyms

b2b012Clo

MMRRC Submission

040438-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2845 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

8169106-8271158 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 8216380 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 1412 (R1412H)

Ref Sequence

ENSEMBL: ENSMUSP00000106247 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110617]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082632

Predicted Effect

probably damaging
Transcript: ENSMUST00000110617
AA Change: R1412H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106247
Gene: ENSMUSG00000039801
AA Change: R1412H

Domain	Start	End	E-Value	Type
low complexity region	144	157	N/A	INTRINSIC
low complexity region	338	352	N/A	INTRINSIC
low complexity region	466	476	N/A	INTRINSIC
low complexity region	868	883	N/A	INTRINSIC
low complexity region	949	962	N/A	INTRINSIC
low complexity region	1400	1415	N/A	INTRINSIC
low complexity region	1449	1464	N/A	INTRINSIC
low complexity region	1827	1838	N/A	INTRINSIC
low complexity region	1919	1930	N/A	INTRINSIC
low complexity region	2130	2145	N/A	INTRINSIC
coiled coil region	2750	2782	N/A	INTRINSIC
low complexity region	2838	2850	N/A	INTRINSIC
Pfam:Joubert	2894	3207	1.9e-136	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154291

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. Defects in this gene are a cause of Joubert syndrome (JBTS). [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes exhibit double outlet right ventricle {SDD}, pulmonary atresia/hypolastic pulmonary artery, atrioventricular septal defect, and right aortic arch. Non-cardiovascular defects include cleft palate, polydactyly, transparent chest wall (sternal bone hypoplasia) and hypoplastic lungs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap25	C	T	6: 87,459,967	E634K	possibly damaging	Het
Atg4a	G	A	X: 140,992,840	E106K	probably benign	Het
Bahd1	G	A	2: 118,922,523	R757H	probably damaging	Het
Cep152	A	G	2: 125,587,974	I676T	probably damaging	Het
Cherp	C	A	8: 72,466,403	A449S	probably damaging	Het
Col19a1	C	T	1: 24,559,681	G77E	unknown	Het
Csnk1g2	A	G	10: 80,638,604	S220G	probably damaging	Het
Efcab7	T	A	4: 99,909,638	V20D	probably damaging	Het
Fhad1	G	T	4: 141,904,968	Q1287K	probably benign	Het
Frem3	T	C	8: 80,613,220	F714S	probably damaging	Het
Gm13088	G	A	4: 143,654,298	S385F	probably damaging	Het
Gpx6	A	T	13: 21,318,875		probably null	Het
Hsd3b1	T	C	3: 98,852,778	E299G	probably damaging	Het
Mark2	T	C	19: 7,286,862	E116G	probably damaging	Het
Mrgpra2a	T	A	7: 47,427,130	M127L	probably benign	Het
Olfr119	T	C	17: 37,700,823	I51T	probably damaging	Het
Pign	C	A	1: 105,657,796	L9F	possibly damaging	Het
Plekha1	G	T	7: 130,908,365	W280C	probably damaging	Het
Plekhh3	T	C	11: 101,170,230		probably benign	Het
Psmd13	C	A	7: 140,897,740		probably benign	Het
Ptpru	T	A	4: 131,819,661	I168F	probably benign	Het
Sbf1	A	G	15: 89,303,218		probably null	Het
Skint10	T	C	4: 112,715,826	S258G	probably benign	Het
Slc15a4	A	G	5: 127,604,536		probably null	Het
Ssh3	T	C	19: 4,265,296	Y338C	probably damaging	Het
Tas2r138	T	C	6: 40,612,767	S182G	probably benign	Het
Tgfbr3l	A	G	8: 4,249,280	D49G	probably damaging	Het
Zbtb8os	A	T	4: 129,341,516	E54D	probably damaging	Het
Zfp24	G	T	18: 24,017,828	T87K	probably damaging	Het
Zfp407	G	T	18: 84,558,397	C1530*	probably null	Het

Other mutations in 2410089E03Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00756:2410089E03Rik	APN	15	8264447	splice site	probably benign
IGL00766:2410089E03Rik	APN	15	8252164	missense	unknown
IGL01483:2410089E03Rik	APN	15	8187107	missense	probably damaging	0.98
IGL01520:2410089E03Rik	APN	15	8221911	missense	probably damaging	0.96
IGL01578:2410089E03Rik	APN	15	8270710	missense	unknown
IGL01701:2410089E03Rik	APN	15	8203257	splice site	probably benign
IGL01892:2410089E03Rik	APN	15	8242265	splice site	probably benign
IGL01895:2410089E03Rik	APN	15	8229107	missense	possibly damaging	0.63
IGL01922:2410089E03Rik	APN	15	8270821	missense	unknown
IGL01978:2410089E03Rik	APN	15	8219382	missense	probably damaging	0.98
IGL02031:2410089E03Rik	APN	15	8179769	missense	probably damaging	0.99
IGL02318:2410089E03Rik	APN	15	8175025	missense	probably damaging	0.98
IGL02321:2410089E03Rik	APN	15	8216572	missense	probably benign	0.04
IGL02363:2410089E03Rik	APN	15	8218437	missense	possibly damaging	0.68
IGL02404:2410089E03Rik	APN	15	8187284	missense	possibly damaging	0.48
IGL02535:2410089E03Rik	APN	15	8174838	missense	probably damaging	1.00
IGL02732:2410089E03Rik	APN	15	8179891	missense	probably benign	0.03
IGL02895:2410089E03Rik	APN	15	8232107	splice site	probably benign
IGL02903:2410089E03Rik	APN	15	8269778	missense	unknown
IGL02903:2410089E03Rik	APN	15	8269779	missense	unknown
IGL02979:2410089E03Rik	APN	15	8218554	missense	possibly damaging	0.82
IGL03077:2410089E03Rik	APN	15	8212795	splice site	probably benign
IGL03196:2410089E03Rik	APN	15	8201342	missense	probably damaging	0.98
IGL03344:2410089E03Rik	APN	15	8187458	missense	possibly damaging	0.63
IGL03368:2410089E03Rik	APN	15	8222373	missense	probably benign	0.06
IGL03403:2410089E03Rik	APN	15	8201342	missense	probably damaging	0.98
agnes	UTSW	15	8246938	nonsense	probably null
dei	UTSW	15	8186165	missense	probably damaging	1.00
R0015:2410089E03Rik	UTSW	15	8186184	missense	probably damaging	1.00
R0015:2410089E03Rik	UTSW	15	8186184	missense	probably damaging	1.00
R0101:2410089E03Rik	UTSW	15	8220960	missense	probably benign	0.00
R0105:2410089E03Rik	UTSW	15	8187392	missense	probably benign
R0105:2410089E03Rik	UTSW	15	8187392	missense	probably benign
R0165:2410089E03Rik	UTSW	15	8216382	missense	probably damaging	1.00
R0306:2410089E03Rik	UTSW	15	8179889	missense	probably damaging	1.00
R0433:2410089E03Rik	UTSW	15	8216562	missense	probably benign	0.00
R0491:2410089E03Rik	UTSW	15	8182243	missense	probably damaging	1.00
R0523:2410089E03Rik	UTSW	15	8194386	missense	probably damaging	1.00
R0571:2410089E03Rik	UTSW	15	8259793	missense	unknown
R0679:2410089E03Rik	UTSW	15	8223122	missense	probably benign	0.39
R0704:2410089E03Rik	UTSW	15	8210083	missense	possibly damaging	0.93
R0707:2410089E03Rik	UTSW	15	8258321	missense	unknown
R0715:2410089E03Rik	UTSW	15	8223092	missense	probably benign	0.14
R0762:2410089E03Rik	UTSW	15	8218416	unclassified	probably benign
R0830:2410089E03Rik	UTSW	15	8247185	missense	unknown
R0924:2410089E03Rik	UTSW	15	8251070	splice site	probably benign
R1071:2410089E03Rik	UTSW	15	8218426	missense	probably benign	0.20
R1184:2410089E03Rik	UTSW	15	8216487	missense	probably benign
R1224:2410089E03Rik	UTSW	15	8178385	missense	probably benign	0.06
R1416:2410089E03Rik	UTSW	15	8246938	nonsense	probably null
R1428:2410089E03Rik	UTSW	15	8219369	missense	possibly damaging	0.83
R1487:2410089E03Rik	UTSW	15	8186231	missense	probably damaging	1.00
R1641:2410089E03Rik	UTSW	15	8228959	missense	probably benign	0.41
R1652:2410089E03Rik	UTSW	15	8201146	missense	probably damaging	1.00
R1688:2410089E03Rik	UTSW	15	8228609	missense	probably benign	0.00
R1715:2410089E03Rik	UTSW	15	8226900	splice site	probably null
R1820:2410089E03Rik	UTSW	15	8269645	missense	unknown
R1863:2410089E03Rik	UTSW	15	8228593	missense	probably benign	0.00
R1940:2410089E03Rik	UTSW	15	8233852	missense	probably damaging	0.98
R1967:2410089E03Rik	UTSW	15	8203420	missense	probably benign	0.09
R2064:2410089E03Rik	UTSW	15	8186165	missense	probably damaging	1.00
R2076:2410089E03Rik	UTSW	15	8219257	missense	possibly damaging	0.93
R2163:2410089E03Rik	UTSW	15	8203251	splice site	probably null
R2208:2410089E03Rik	UTSW	15	8194403	missense	probably benign	0.33
R2504:2410089E03Rik	UTSW	15	8219216	missense	probably damaging	0.99
R2568:2410089E03Rik	UTSW	15	8201269	missense	possibly damaging	0.70
R2913:2410089E03Rik	UTSW	15	8270685	missense	unknown
R3056:2410089E03Rik	UTSW	15	8251007	missense	unknown
R3706:2410089E03Rik	UTSW	15	8259816	missense	unknown
R3707:2410089E03Rik	UTSW	15	8259816	missense	unknown
R3870:2410089E03Rik	UTSW	15	8218464	missense	probably damaging	0.98
R3877:2410089E03Rik	UTSW	15	8221943	missense	probably benign
R3886:2410089E03Rik	UTSW	15	8171805	missense	probably damaging	0.98
R4057:2410089E03Rik	UTSW	15	8219025	missense	probably benign	0.08
R4090:2410089E03Rik	UTSW	15	8212358	splice site	probably null
R4362:2410089E03Rik	UTSW	15	8270745	missense	unknown
R4363:2410089E03Rik	UTSW	15	8270745	missense	unknown
R4445:2410089E03Rik	UTSW	15	8252188	missense	unknown
R4581:2410089E03Rik	UTSW	15	8171798	missense	possibly damaging	0.85
R4587:2410089E03Rik	UTSW	15	8201152	missense	possibly damaging	0.50
R4659:2410089E03Rik	UTSW	15	8216276	intron	probably benign
R4663:2410089E03Rik	UTSW	15	8218455	missense	probably benign	0.31
R4779:2410089E03Rik	UTSW	15	8218838	missense	probably benign	0.04
R4812:2410089E03Rik	UTSW	15	8201123	splice site	probably null
R4850:2410089E03Rik	UTSW	15	8262938	missense	unknown
R4896:2410089E03Rik	UTSW	15	8221937	missense	probably benign	0.00
R5273:2410089E03Rik	UTSW	15	8244341	missense	probably damaging	0.98
R5273:2410089E03Rik	UTSW	15	8262938	missense	unknown
R5303:2410089E03Rik	UTSW	15	8260690	splice site	probably null
R5307:2410089E03Rik	UTSW	15	8260690	splice site	probably null
R5308:2410089E03Rik	UTSW	15	8260690	splice site	probably null
R5373:2410089E03Rik	UTSW	15	8270803	missense	unknown
R5374:2410089E03Rik	UTSW	15	8270803	missense	unknown
R5386:2410089E03Rik	UTSW	15	8194413	missense	probably damaging	1.00
R5534:2410089E03Rik	UTSW	15	8228835	missense	probably benign	0.06
R5720:2410089E03Rik	UTSW	15	8203687	missense	probably benign	0.35
R5891:2410089E03Rik	UTSW	15	8188589	missense	probably benign	0.00
R5932:2410089E03Rik	UTSW	15	8244595	splice site	probably null
R6053:2410089E03Rik	UTSW	15	8188461	missense	probably benign	0.35
R6166:2410089E03Rik	UTSW	15	8186560	missense	probably benign	0.00
R6245:2410089E03Rik	UTSW	15	8178418	missense	probably benign	0.01
R6246:2410089E03Rik	UTSW	15	8210014	missense	probably damaging	1.00
R6541:2410089E03Rik	UTSW	15	8219295	missense	possibly damaging	0.48
R6622:2410089E03Rik	UTSW	15	8244222	missense	probably damaging	0.98
R6707:2410089E03Rik	UTSW	15	8223122	missense	probably benign	0.39
R6729:2410089E03Rik	UTSW	15	8188601	splice site	probably null
R6805:2410089E03Rik	UTSW	15	8244306	missense	probably benign	0.07
R6806:2410089E03Rik	UTSW	15	8186858	missense	possibly damaging	0.55
R6813:2410089E03Rik	UTSW	15	8229282	missense	probably benign
R6830:2410089E03Rik	UTSW	15	8176184	missense	probably benign	0.04
R6845:2410089E03Rik	UTSW	15	8221904	missense	possibly damaging	0.84
R6894:2410089E03Rik	UTSW	15	8187368	missense	probably damaging	0.99
R6970:2410089E03Rik	UTSW	15	8187548	missense	probably benign	0.01
R6991:2410089E03Rik	UTSW	15	8252206	missense	unknown
R7003:2410089E03Rik	UTSW	15	8228762	missense	probably damaging	0.99
R7088:2410089E03Rik	UTSW	15	8218947	missense	probably benign	0.16
R7104:2410089E03Rik	UTSW	15	8194444	missense	possibly damaging	0.83
R7311:2410089E03Rik	UTSW	15	8180915	missense	probably damaging	1.00
R7374:2410089E03Rik	UTSW	15	8247247	missense	unknown
R7446:2410089E03Rik	UTSW	15	8232080	missense	probably damaging	0.98
R7539:2410089E03Rik	UTSW	15	8201244	missense	probably benign	0.19
R7543:2410089E03Rik	UTSW	15	8225392	missense	unknown
R7558:2410089E03Rik	UTSW	15	8225367	missense	unknown
R7629:2410089E03Rik	UTSW	15	8227067	nonsense	probably null
R7635:2410089E03Rik	UTSW	15	8226920	missense	probably benign	0.01
R7644:2410089E03Rik	UTSW	15	8223127	missense	probably benign	0.00
R7705:2410089E03Rik	UTSW	15	8182252	missense	probably damaging	1.00
R7752:2410089E03Rik	UTSW	15	8269706	missense	unknown
R7754:2410089E03Rik	UTSW	15	8243826	missense	possibly damaging	0.53
R7757:2410089E03Rik	UTSW	15	8252227	missense	unknown
R7836:2410089E03Rik	UTSW	15	8203757	missense	probably damaging	0.97
R7875:2410089E03Rik	UTSW	15	8209962	missense	probably benign	0.18
R7901:2410089E03Rik	UTSW	15	8269706	missense	unknown
R7983:2410089E03Rik	UTSW	15	8221815	missense	probably benign	0.01
R8030:2410089E03Rik	UTSW	15	8230303	missense	probably damaging	1.00
R8088:2410089E03Rik	UTSW	15	8186318	missense	probably benign	0.00
R8231:2410089E03Rik	UTSW	15	8219027	missense	probably benign	0.16
R8443:2410089E03Rik	UTSW	15	8201151	missense	probably benign	0.03
R8480:2410089E03Rik	UTSW	15	8187458	missense	possibly damaging	0.63
R8693:2410089E03Rik	UTSW	15	8229008	missense	probably benign	0.15
R8785:2410089E03Rik	UTSW	15	8174760	missense	probably benign	0.39
R8791:2410089E03Rik	UTSW	15	8187260	missense	probably damaging	1.00
R8822:2410089E03Rik	UTSW	15	8171778	missense	probably damaging	1.00
R8831:2410089E03Rik	UTSW	15	8182136	missense	probably benign	0.09
R8932:2410089E03Rik	UTSW	15	8194375	missense	probably damaging	1.00
R8968:2410089E03Rik	UTSW	15	8201281	missense	possibly damaging	0.84
R8973:2410089E03Rik	UTSW	15	8203793	missense	probably damaging	1.00
R9036:2410089E03Rik	UTSW	15	8223138	missense	possibly damaging	0.63
R9134:2410089E03Rik	UTSW	15	8199232	missense	probably damaging	0.99
R9197:2410089E03Rik	UTSW	15	8251052	missense	unknown
R9259:2410089E03Rik	UTSW	15	8203303	missense	possibly damaging	0.82
R9269:2410089E03Rik	UTSW	15	8219016	missense	probably damaging	0.97
R9294:2410089E03Rik	UTSW	15	8203327	missense	probably benign	0.00
R9328:2410089E03Rik	UTSW	15	8186208	missense	probably damaging	1.00
R9563:2410089E03Rik	UTSW	15	8187079	missense	probably benign	0.20
R9680:2410089E03Rik	UTSW	15	8202301	missense	possibly damaging	0.68
R9721:2410089E03Rik	UTSW	15	8225409	missense	unknown
R9779:2410089E03Rik	UTSW	15	8201302	missense	possibly damaging	0.93
R9780:2410089E03Rik	UTSW	15	8228639	missense	probably benign	0.00
U24488:2410089E03Rik	UTSW	15	8182210	missense	probably damaging	1.00
X0023:2410089E03Rik	UTSW	15	8247031	missense	unknown
Z1177:2410089E03Rik	UTSW	15	8174972	missense	probably damaging	1.00
Z1177:2410089E03Rik	UTSW	15	8209989	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CAGGCAGAATTGGATCCCTTTC -3'
(R):5'- TCCAAAGACAAGGTTTCGGAG -3'

Sequencing Primer
(F):5'- CTTTGACACAGGCTTGTAGC -3'
(R):5'- TCGGAGAAGGTGTCGGCATC -3'

Posted On

2014-12-04