Incidental Mutation 'R2845:Sbf1'
ID 251543
Institutional Source Beutler Lab
Gene Symbol Sbf1
Ensembl Gene ENSMUSG00000036529
Gene Name SET binding factor 1
Synonyms B230113C15Rik, 2610510A08Rik, Mtmr5
MMRRC Submission 040438-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.572) question?
Stock # R2845 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 89172439-89199514 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 89187421 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123791] [ENSMUST00000124576] [ENSMUST00000144585] [ENSMUST00000146637]
AlphaFold Q6ZPE2
PDB Structure Solution Structure of the C-terminal Pleckstrin Homology Domain of Sbf1 from Mouse [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000123791
SMART Domains Protein: ENSMUSP00000120725
Gene: ENSMUSG00000036529

DomainStartEndE-ValueType
uDENN 1 86 6.68e-31 SMART
DENN 128 310 4.05e-71 SMART
dDENN 363 432 1.28e-18 SMART
Pfam:SBF2 540 764 4.1e-110 PFAM
GRAM 882 968 3.93e-12 SMART
Pfam:Myotub-related 1100 1534 6.2e-114 PFAM
low complexity region 1614 1621 N/A INTRINSIC
low complexity region 1652 1666 N/A INTRINSIC
low complexity region 1719 1750 N/A INTRINSIC
PH 1762 1867 6.45e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124576
SMART Domains Protein: ENSMUSP00000115740
Gene: ENSMUSG00000036529

DomainStartEndE-ValueType
uDENN 1 86 6.68e-31 SMART
DENN 128 310 4.05e-71 SMART
Pfam:dDENN 363 403 4.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124642
SMART Domains Protein: ENSMUSP00000119943
Gene: ENSMUSG00000036529

DomainStartEndE-ValueType
Pfam:SBF2 1 94 1.2e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000144585
SMART Domains Protein: ENSMUSP00000118107
Gene: ENSMUSG00000036529

DomainStartEndE-ValueType
uDENN 1 86 6.68e-31 SMART
DENN 128 310 4.05e-71 SMART
dDENN 363 432 1.28e-18 SMART
Pfam:SBF2 542 764 2.3e-108 PFAM
GRAM 882 968 3.93e-12 SMART
Pfam:Myotub-related 1106 1558 5.7e-93 PFAM
low complexity region 1640 1647 N/A INTRINSIC
low complexity region 1678 1692 N/A INTRINSIC
low complexity region 1745 1776 N/A INTRINSIC
PH 1788 1893 6.45e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146637
SMART Domains Protein: ENSMUSP00000122386
Gene: ENSMUSG00000036529

DomainStartEndE-ValueType
DENN 20 210 8.29e-68 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155146
Meta Mutation Damage Score 0.9585 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein-tyrosine phosphatase family. However, the encoded protein does not appear to be a catalytically active phosphatase because it lacks several amino acids in the catalytic pocket. This protein contains a Guanine nucleotide exchange factor (GEF) domain which is necessary for its role in growth and differentiation. Mutations in this gene have been associated with Charcot-Marie-Tooth disease 4B3. Pseudogenes of this gene have been defined on chromosomes 1 and 8. [provided by RefSeq, Dec 2014]
PHENOTYPE: Male homozygotes for a targeted null mutation exhibit male infertility associated with azoospermia, vacuolation of Sertoli cells, reduced spermatid formation, and eventual depletion of germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap25 C T 6: 87,436,949 (GRCm39) E634K possibly damaging Het
Atg4a G A X: 139,893,589 (GRCm39) E106K probably benign Het
Bahd1 G A 2: 118,753,004 (GRCm39) R757H probably damaging Het
Cep152 A G 2: 125,429,894 (GRCm39) I676T probably damaging Het
Cherp C A 8: 73,220,247 (GRCm39) A449S probably damaging Het
Col19a1 C T 1: 24,598,762 (GRCm39) G77E unknown Het
Cplane1 G A 15: 8,245,864 (GRCm39) R1412H probably damaging Het
Csnk1g2 A G 10: 80,474,438 (GRCm39) S220G probably damaging Het
Efcab7 T A 4: 99,766,835 (GRCm39) V20D probably damaging Het
Fhad1 G T 4: 141,632,279 (GRCm39) Q1287K probably benign Het
Frem3 T C 8: 81,339,849 (GRCm39) F714S probably damaging Het
Gpx6 A T 13: 21,503,045 (GRCm39) probably null Het
Hsd3b1 T C 3: 98,760,094 (GRCm39) E299G probably damaging Het
Mark2 T C 19: 7,264,227 (GRCm39) E116G probably damaging Het
Mrgpra2a T A 7: 47,076,878 (GRCm39) M127L probably benign Het
Or10al3 T C 17: 38,011,714 (GRCm39) I51T probably damaging Het
Pign C A 1: 105,585,521 (GRCm39) L9F possibly damaging Het
Plekha1 G T 7: 130,510,095 (GRCm39) W280C probably damaging Het
Plekhh3 T C 11: 101,061,056 (GRCm39) probably benign Het
Pramel22 G A 4: 143,380,868 (GRCm39) S385F probably damaging Het
Psmd13 C A 7: 140,477,653 (GRCm39) probably benign Het
Ptpru T A 4: 131,546,972 (GRCm39) I168F probably benign Het
Skint10 T C 4: 112,573,023 (GRCm39) S258G probably benign Het
Slc15a4 A G 5: 127,681,600 (GRCm39) probably null Het
Ssh3 T C 19: 4,315,324 (GRCm39) Y338C probably damaging Het
Tas2r138 T C 6: 40,589,701 (GRCm39) S182G probably benign Het
Tgfbr3l A G 8: 4,299,280 (GRCm39) D49G probably damaging Het
Zbtb8os A T 4: 129,235,309 (GRCm39) E54D probably damaging Het
Zfp24 G T 18: 24,150,885 (GRCm39) T87K probably damaging Het
Zfp407 G T 18: 84,576,522 (GRCm39) C1530* probably null Het
Other mutations in Sbf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00265:Sbf1 APN 15 89,189,778 (GRCm39) missense probably damaging 0.98
IGL01478:Sbf1 APN 15 89,183,946 (GRCm39) missense probably damaging 0.97
IGL01533:Sbf1 APN 15 89,172,919 (GRCm39) missense probably damaging 0.99
IGL01603:Sbf1 APN 15 89,187,481 (GRCm39) missense probably damaging 1.00
IGL01758:Sbf1 APN 15 89,187,418 (GRCm39) unclassified probably benign
IGL01908:Sbf1 APN 15 89,186,929 (GRCm39) missense probably damaging 1.00
IGL02067:Sbf1 APN 15 89,173,247 (GRCm39) missense probably damaging 1.00
IGL02089:Sbf1 APN 15 89,186,708 (GRCm39) nonsense probably null
IGL02150:Sbf1 APN 15 89,179,683 (GRCm39) missense probably benign 0.00
IGL02284:Sbf1 APN 15 89,189,281 (GRCm39) missense probably damaging 1.00
IGL02367:Sbf1 APN 15 89,191,775 (GRCm39) missense probably damaging 0.99
IGL02427:Sbf1 APN 15 89,190,188 (GRCm39) unclassified probably benign
IGL03025:Sbf1 APN 15 89,173,848 (GRCm39) missense probably damaging 1.00
IGL03103:Sbf1 APN 15 89,178,150 (GRCm39) missense probably damaging 1.00
IGL03226:Sbf1 APN 15 89,173,308 (GRCm39) missense possibly damaging 0.93
IGL03376:Sbf1 APN 15 89,173,219 (GRCm39) unclassified probably benign
IGL03397:Sbf1 APN 15 89,172,924 (GRCm39) missense probably damaging 1.00
R0043:Sbf1 UTSW 15 89,179,764 (GRCm39) missense probably benign 0.26
R0139:Sbf1 UTSW 15 89,186,701 (GRCm39) missense probably damaging 1.00
R0528:Sbf1 UTSW 15 89,172,915 (GRCm39) missense probably damaging 0.99
R0624:Sbf1 UTSW 15 89,186,532 (GRCm39) missense possibly damaging 0.68
R0759:Sbf1 UTSW 15 89,188,919 (GRCm39) missense probably damaging 1.00
R1555:Sbf1 UTSW 15 89,189,279 (GRCm39) missense probably damaging 1.00
R1763:Sbf1 UTSW 15 89,178,628 (GRCm39) missense probably damaging 1.00
R2025:Sbf1 UTSW 15 89,186,933 (GRCm39) missense probably damaging 1.00
R2207:Sbf1 UTSW 15 89,190,896 (GRCm39) missense possibly damaging 0.88
R2844:Sbf1 UTSW 15 89,187,421 (GRCm39) critical splice donor site probably null
R3788:Sbf1 UTSW 15 89,183,731 (GRCm39) nonsense probably null
R4108:Sbf1 UTSW 15 89,172,788 (GRCm39) unclassified probably benign
R4403:Sbf1 UTSW 15 89,178,157 (GRCm39) missense possibly damaging 0.94
R4605:Sbf1 UTSW 15 89,187,684 (GRCm39) missense probably damaging 1.00
R4620:Sbf1 UTSW 15 89,191,129 (GRCm39) missense probably damaging 0.99
R4666:Sbf1 UTSW 15 89,179,449 (GRCm39) missense probably damaging 1.00
R4696:Sbf1 UTSW 15 89,187,315 (GRCm39) nonsense probably null
R4697:Sbf1 UTSW 15 89,199,288 (GRCm39) missense possibly damaging 0.71
R4747:Sbf1 UTSW 15 89,186,916 (GRCm39) missense probably damaging 1.00
R5828:Sbf1 UTSW 15 89,172,837 (GRCm39) missense probably damaging 1.00
R5841:Sbf1 UTSW 15 89,192,271 (GRCm39) missense probably damaging 1.00
R6185:Sbf1 UTSW 15 89,189,814 (GRCm39) missense probably damaging 1.00
R6237:Sbf1 UTSW 15 89,177,679 (GRCm39) missense probably benign 0.29
R6256:Sbf1 UTSW 15 89,185,070 (GRCm39) missense probably benign 0.06
R6490:Sbf1 UTSW 15 89,189,111 (GRCm39) missense probably benign
R6933:Sbf1 UTSW 15 89,184,572 (GRCm39) missense probably damaging 1.00
R7806:Sbf1 UTSW 15 89,189,623 (GRCm39) missense possibly damaging 0.52
R7921:Sbf1 UTSW 15 89,190,426 (GRCm39) missense probably damaging 0.96
R8005:Sbf1 UTSW 15 89,178,408 (GRCm39) missense probably damaging 0.98
R8350:Sbf1 UTSW 15 89,183,712 (GRCm39) missense probably damaging 0.99
R8450:Sbf1 UTSW 15 89,183,712 (GRCm39) missense probably damaging 0.99
R8509:Sbf1 UTSW 15 89,177,660 (GRCm39) missense probably damaging 1.00
R8753:Sbf1 UTSW 15 89,179,662 (GRCm39) missense probably benign
R8788:Sbf1 UTSW 15 89,186,062 (GRCm39) missense probably damaging 1.00
R9182:Sbf1 UTSW 15 89,173,806 (GRCm39) critical splice donor site probably null
R9516:Sbf1 UTSW 15 89,184,742 (GRCm39) missense probably damaging 1.00
R9608:Sbf1 UTSW 15 89,191,808 (GRCm39) critical splice acceptor site probably null
R9673:Sbf1 UTSW 15 89,179,675 (GRCm39) missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GGCTGAACACAGTGCTTTCC -3'
(R):5'- TGTGAGCTCATGACCTTTCTAAC -3'

Sequencing Primer
(F):5'- GAACACAGTGCTTTCCTCCTTCTG -3'
(R):5'- ACTTCATTCCTATAGAAGCTGAGCC -3'
Posted On 2014-12-04