Incidental Mutation 'R2845:Olfr119'
ID 251545
Institutional Source Beutler Lab
Gene Symbol Olfr119
Ensembl Gene ENSMUSG00000059964
Gene Name olfactory receptor 119
Synonyms MOR263-7, GA_x6K02T2PSCP-2159633-2160598
MMRRC Submission 040438-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R2845 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 37696564-37702124 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37700823 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 51 (I51T)
Ref Sequence ENSEMBL: ENSMUSP00000150099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080483] [ENSMUST00000213732]
AlphaFold Q7TRJ5
Predicted Effect probably damaging
Transcript: ENSMUST00000080483
AA Change: I51T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092919
Gene: ENSMUSG00000059964
AA Change: I51T

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 5.6e-59 PFAM
Pfam:7TM_GPCR_Srsx 41 311 1.7e-5 PFAM
Pfam:7tm_1 47 296 3.1e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213732
AA Change: I51T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,216,380 R1412H probably damaging Het
Arhgap25 C T 6: 87,459,967 E634K possibly damaging Het
Atg4a G A X: 140,992,840 E106K probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Cep152 A G 2: 125,587,974 I676T probably damaging Het
Cherp C A 8: 72,466,403 A449S probably damaging Het
Col19a1 C T 1: 24,559,681 G77E unknown Het
Csnk1g2 A G 10: 80,638,604 S220G probably damaging Het
Efcab7 T A 4: 99,909,638 V20D probably damaging Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Frem3 T C 8: 80,613,220 F714S probably damaging Het
Gm13088 G A 4: 143,654,298 S385F probably damaging Het
Gpx6 A T 13: 21,318,875 probably null Het
Hsd3b1 T C 3: 98,852,778 E299G probably damaging Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Mrgpra2a T A 7: 47,427,130 M127L probably benign Het
Pign C A 1: 105,657,796 L9F possibly damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Plekhh3 T C 11: 101,170,230 probably benign Het
Psmd13 C A 7: 140,897,740 probably benign Het
Ptpru T A 4: 131,819,661 I168F probably benign Het
Sbf1 A G 15: 89,303,218 probably null Het
Skint10 T C 4: 112,715,826 S258G probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
Tas2r138 T C 6: 40,612,767 S182G probably benign Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zfp24 G T 18: 24,017,828 T87K probably damaging Het
Zfp407 G T 18: 84,558,397 C1530* probably null Het
Other mutations in Olfr119
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02209:Olfr119 APN 17 37700992 missense probably damaging 1.00
IGL03339:Olfr119 APN 17 37700791 missense probably damaging 0.99
R0092:Olfr119 UTSW 17 37700805 missense probably damaging 0.98
R0207:Olfr119 UTSW 17 37701058 nonsense probably null
R0378:Olfr119 UTSW 17 37701041 missense probably damaging 1.00
R0408:Olfr119 UTSW 17 37701299 missense probably benign
R0483:Olfr119 UTSW 17 37701297 missense probably benign 0.01
R1595:Olfr119 UTSW 17 37701113 missense probably benign 0.03
R1901:Olfr119 UTSW 17 37701421 missense probably damaging 1.00
R1902:Olfr119 UTSW 17 37701421 missense probably damaging 1.00
R2846:Olfr119 UTSW 17 37700823 missense probably damaging 1.00
R4356:Olfr119 UTSW 17 37700899 missense probably damaging 0.97
R4381:Olfr119 UTSW 17 37700899 missense probably damaging 0.97
R6744:Olfr119 UTSW 17 37701445 nonsense probably null
R7674:Olfr119 UTSW 17 37700682 missense probably benign 0.03
R7677:Olfr119 UTSW 17 37701066 missense probably damaging 1.00
R7994:Olfr119 UTSW 17 37701435 missense probably damaging 0.99
R8305:Olfr119 UTSW 17 37701498 missense probably benign 0.10
R8512:Olfr119 UTSW 17 37701180 missense probably damaging 1.00
R9300:Olfr119 UTSW 17 37700924 missense probably damaging 1.00
R9760:Olfr119 UTSW 17 37701543 missense probably damaging 1.00
Z1177:Olfr119 UTSW 17 37701053 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTGTCCTTTCTTTCAGGAGATGAG -3'
(R):5'- GCAGCGGTCATAAGCCATAG -3'

Sequencing Primer
(F):5'- CAGGAGATGAGTATCAACTGCTCTC -3'
(R):5'- GCCATAGCTGCCAGTAGACAG -3'
Posted On 2014-12-04