Incidental Mutation 'R2845:Zfp24'
ID251547
Institutional Source Beutler Lab
Gene Symbol Zfp24
Ensembl Gene ENSMUSG00000051469
Gene Namezinc finger protein 24
SynonymsZF-12, Zfp191, KOX17, 3526401F17Rik, 5033419P20Rik
MMRRC Submission 040438-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2845 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location24009702-24020810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24017828 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 87 (T87K)
Ref Sequence ENSEMBL: ENSMUSP00000122579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066497] [ENSMUST00000148525] [ENSMUST00000153337]
Predicted Effect probably damaging
Transcript: ENSMUST00000066497
AA Change: T87K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000064637
Gene: ENSMUSG00000051469
AA Change: T87K

DomainStartEndE-ValueType
SCAN 48 160 1.75e-73 SMART
ZnF_C2H2 251 273 3.63e-3 SMART
ZnF_C2H2 279 301 5.06e-2 SMART
ZnF_C2H2 307 329 9.08e-4 SMART
ZnF_C2H2 335 357 2.4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148525
Predicted Effect probably damaging
Transcript: ENSMUST00000153337
AA Change: T87K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122579
Gene: ENSMUSG00000051469
AA Change: T87K

DomainStartEndE-ValueType
SCAN 48 160 1.75e-73 SMART
ZnF_C2H2 251 273 3.63e-3 SMART
ZnF_C2H2 279 301 5.06e-2 SMART
ZnF_C2H2 307 329 9.08e-4 SMART
ZnF_C2H2 335 357 2.4e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous null for one mutation have hypomyelination of the central nervous system, tremors, tonic seizures and premature death, whereas mice homozygous null for another mutation are embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,216,380 R1412H probably damaging Het
Arhgap25 C T 6: 87,459,967 E634K possibly damaging Het
Atg4a G A X: 140,992,840 E106K probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Cep152 A G 2: 125,587,974 I676T probably damaging Het
Cherp C A 8: 72,466,403 A449S probably damaging Het
Col19a1 C T 1: 24,559,681 G77E unknown Het
Csnk1g2 A G 10: 80,638,604 S220G probably damaging Het
Efcab7 T A 4: 99,909,638 V20D probably damaging Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Frem3 T C 8: 80,613,220 F714S probably damaging Het
Gm13088 G A 4: 143,654,298 S385F probably damaging Het
Gpx6 A T 13: 21,318,875 probably null Het
Hsd3b1 T C 3: 98,852,778 E299G probably damaging Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Mrgpra2a T A 7: 47,427,130 M127L probably benign Het
Olfr119 T C 17: 37,700,823 I51T probably damaging Het
Pign C A 1: 105,657,796 L9F possibly damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Plekhh3 T C 11: 101,170,230 probably benign Het
Psmd13 C A 7: 140,897,740 probably benign Het
Ptpru T A 4: 131,819,661 I168F probably benign Het
Sbf1 A G 15: 89,303,218 probably null Het
Skint10 T C 4: 112,715,826 S258G probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
Tas2r138 T C 6: 40,612,767 S182G probably benign Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zfp407 G T 18: 84,558,397 C1530* probably null Het
Other mutations in Zfp24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02750:Zfp24 APN 18 24017353 missense possibly damaging 0.48
R1573:Zfp24 UTSW 18 24017342 missense possibly damaging 0.70
R1946:Zfp24 UTSW 18 24014419 frame shift probably null
R2508:Zfp24 UTSW 18 24017870 missense probably damaging 1.00
R4119:Zfp24 UTSW 18 24014569 missense possibly damaging 0.86
R4471:Zfp24 UTSW 18 24018115 start gained probably benign
R5847:Zfp24 UTSW 18 24018038 missense possibly damaging 0.93
R6091:Zfp24 UTSW 18 24014212 missense probably damaging 1.00
R6659:Zfp24 UTSW 18 24017334 missense possibly damaging 0.61
Y4338:Zfp24 UTSW 18 24017855 missense possibly damaging 0.55
Y4338:Zfp24 UTSW 18 24017868 missense probably damaging 1.00
Y5409:Zfp24 UTSW 18 24017855 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GAAGTTAACTCAGCAGTGTGCC -3'
(R):5'- TCCTGATGGTGAAGAGGGATC -3'

Sequencing Primer
(F):5'- AGTTAACTCAGCAGTGTGCCTACTG -3'
(R):5'- GGATCGAGCATTTCCTGGAAC -3'
Posted On2014-12-04