Incidental Mutation 'R2846:Pign'
ID251565
Institutional Source Beutler Lab
Gene Symbol Pign
Ensembl Gene ENSMUSG00000056536
Gene Namephosphatidylinositol glycan anchor biosynthesis, class N
Synonyms
MMRRC Submission 040439-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.799) question?
Stock #R2846 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location105518422-105663677 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 105657796 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 9 (L9F)
Ref Sequence ENSEMBL: ENSMUSP00000140020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070699] [ENSMUST00000186485] [ENSMUST00000187537] [ENSMUST00000190811]
Predicted Effect probably benign
Transcript: ENSMUST00000070699
AA Change: L9F

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000069969
Gene: ENSMUSG00000056536
AA Change: L9F

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Phosphodiest 116 303 1.2e-10 PFAM
Pfam:Sulfatase 148 334 2.1e-8 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 884 2.3e-138 PFAM
transmembrane domain 893 915 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185983
Predicted Effect probably benign
Transcript: ENSMUST00000186485
AA Change: L9F

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139638
Gene: ENSMUSG00000056536
AA Change: L9F

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Phosphodiest 109 330 3.7e-11 PFAM
Pfam:Sulfatase 148 334 2.1e-8 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 884 1.5e-141 PFAM
transmembrane domain 893 915 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187537
AA Change: L9F

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140020
Gene: ENSMUSG00000056536
AA Change: L9F

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Phosphodiest 46 331 1.2e-12 PFAM
Pfam:Sulfatase 146 334 2.9e-6 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 800 5.9e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187909
Predicted Effect possibly damaging
Transcript: ENSMUST00000190811
AA Change: L9F

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140844
Gene: ENSMUSG00000056536
AA Change: L9F

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Phosphodiest 46 331 1.1e-12 PFAM
Pfam:Sulfatase 146 334 2.8e-6 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 794 4.4e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191408
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This protein is expressed in the endoplasmic reticulum and transfers phosphoethanolamine (EtNP) to the first mannose of the GPI anchor. Two alternatively spliced variants, which encode an identical isoform, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit abnormal gastrulation, forebrain hypoplasia, coloboma, and microphthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg4a G A X: 140,992,840 E106K probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Cdnf T A 2: 3,513,128 M1K probably null Het
Ddx4 T A 13: 112,604,612 K496M probably damaging Het
Dlg1 T C 16: 31,863,197 S779P probably damaging Het
Dtna T A 18: 23,651,503 probably null Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Gal3st2c A T 1: 93,996,400 Q8L possibly damaging Het
Hsd3b1 T C 3: 98,852,778 E299G probably damaging Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Irs4 C A X: 141,724,340 G287W probably damaging Het
Kif21a T C 15: 90,934,464 I1570V probably benign Het
Kremen1 GG GGGCG 11: 5,201,793 probably benign Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mindy4 T C 6: 55,278,100 V521A probably damaging Het
Olfr119 T C 17: 37,700,823 I51T probably damaging Het
Olfr384 A T 11: 73,603,383 T268S probably benign Het
Pdgfrb C T 18: 61,064,016 P175S probably benign Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Ppfia3 C A 7: 45,356,428 R348L probably damaging Het
Prr12 G C 7: 45,046,012 S1343R unknown Het
Psmd13 C A 7: 140,897,740 probably benign Het
Qpct A G 17: 79,070,742 T114A probably damaging Het
Sec24d A G 3: 123,350,746 D624G probably damaging Het
Shank2 A G 7: 144,070,055 Y259C probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Smarcb1 C A 10: 75,897,541 R332L probably damaging Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
St18 T A 1: 6,845,587 C819S probably damaging Het
Tas2r124 A G 6: 132,755,267 N180D possibly damaging Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Tmem204 G A 17: 25,080,333 H71Y probably benign Het
Vmn1r212 A G 13: 22,884,092 S24P probably damaging Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zmiz1 A G 14: 25,645,675 S259G probably benign Het
Other mutations in Pign
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Pign APN 1 105597723 nonsense probably null
IGL00770:Pign APN 1 105597756 missense probably benign 0.00
IGL00774:Pign APN 1 105597756 missense probably benign 0.00
IGL00828:Pign APN 1 105554120 missense probably damaging 0.97
IGL01407:Pign APN 1 105589302 missense probably benign 0.06
IGL01523:Pign APN 1 105653178 missense probably damaging 0.98
IGL01953:Pign APN 1 105589039 splice site probably benign
IGL02389:Pign APN 1 105646781 nonsense probably null
PIT4810001:Pign UTSW 1 105597762 missense possibly damaging 0.83
R0080:Pign UTSW 1 105552405 missense probably damaging 1.00
R0097:Pign UTSW 1 105587976 splice site probably benign
R0302:Pign UTSW 1 105589093 missense possibly damaging 0.83
R0573:Pign UTSW 1 105653177 missense probably damaging 1.00
R0580:Pign UTSW 1 105591694 missense probably benign 0.03
R0946:Pign UTSW 1 105591697 missense probably benign 0.00
R1397:Pign UTSW 1 105657771 missense probably damaging 1.00
R1462:Pign UTSW 1 105585002 missense possibly damaging 0.95
R1462:Pign UTSW 1 105585002 missense possibly damaging 0.95
R1751:Pign UTSW 1 105653192 missense probably benign 0.19
R1753:Pign UTSW 1 105589317 missense possibly damaging 0.65
R1767:Pign UTSW 1 105653192 missense probably benign 0.19
R1854:Pign UTSW 1 105554498 missense probably damaging 0.99
R1907:Pign UTSW 1 105638215 missense possibly damaging 0.50
R2845:Pign UTSW 1 105657796 missense possibly damaging 0.80
R3718:Pign UTSW 1 105649281 critical splice donor site probably null
R3970:Pign UTSW 1 105656003 missense probably damaging 1.00
R4067:Pign UTSW 1 105587978 critical splice donor site probably null
R4110:Pign UTSW 1 105553815 unclassified probably benign
R4387:Pign UTSW 1 105522060 missense possibly damaging 0.48
R4393:Pign UTSW 1 105522026 missense probably benign 0.00
R4472:Pign UTSW 1 105648220 missense probably benign 0.29
R4519:Pign UTSW 1 105597666 critical splice donor site probably null
R4619:Pign UTSW 1 105521990 utr 3 prime probably benign
R4746:Pign UTSW 1 105585024 missense probably benign 0.33
R4859:Pign UTSW 1 105648167 nonsense probably null
R4893:Pign UTSW 1 105646711 missense probably damaging 1.00
R4953:Pign UTSW 1 105644502 missense probably benign 0.32
R5046:Pign UTSW 1 105522073 missense possibly damaging 0.94
R5377:Pign UTSW 1 105657812 missense probably benign 0.12
R5388:Pign UTSW 1 105655970 missense probably damaging 1.00
R5482:Pign UTSW 1 105546710 missense probably benign 0.44
R5594:Pign UTSW 1 105646869 intron probably benign
R5639:Pign UTSW 1 105589315 missense probably benign 0.09
R5778:Pign UTSW 1 105591722 missense probably damaging 1.00
R5821:Pign UTSW 1 105589063 missense possibly damaging 0.95
R5928:Pign UTSW 1 105558067 missense possibly damaging 0.55
R5979:Pign UTSW 1 105589274 missense probably benign 0.01
R6213:Pign UTSW 1 105589266 missense possibly damaging 0.50
R6292:Pign UTSW 1 105585077 missense possibly damaging 0.69
R6343:Pign UTSW 1 105585095 missense probably benign 0.33
R6566:Pign UTSW 1 105638181 critical splice donor site probably null
R6856:Pign UTSW 1 105553895 nonsense probably null
R6954:Pign UTSW 1 105553897 missense probably benign 0.39
R7361:Pign UTSW 1 105585053 missense probably benign 0.01
R7582:Pign UTSW 1 105649367 missense probably benign 0.00
R7622:Pign UTSW 1 105648117 missense possibly damaging 0.65
R7742:Pign UTSW 1 105552397 missense probably benign
R7892:Pign UTSW 1 105657676 missense probably benign 0.01
R7975:Pign UTSW 1 105657676 missense probably benign 0.01
X0025:Pign UTSW 1 105657634 missense probably benign 0.03
Z1177:Pign UTSW 1 105657820 start codon destroyed probably null 0.98
Predicted Primers PCR Primer
(F):5'- AAAGGTGCTCTGGAGTTTCC -3'
(R):5'- GATTTCCTGTGAATGAGCCTAAC -3'

Sequencing Primer
(F):5'- GGCCATCAGCAACAAATAG -3'
(R):5'- GAGCCTAACTAATTTTTCAGTGCC -3'
Posted On2014-12-04