Incidental Mutation 'R2508:Scn11a'
ID 251566
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Name sodium channel, voltage-gated, type XI, alpha
Synonyms NaN, NSS2, NaT, SNS2
MMRRC Submission 040414-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R2508 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 119582829-119654522 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 119594595 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 1266 (Y1266F)
Ref Sequence ENSEMBL: ENSMUSP00000149420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
AlphaFold Q9R053
Predicted Effect probably damaging
Transcript: ENSMUST00000070617
AA Change: Y1266F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: Y1266F

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215718
AA Change: Y1266F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik C T 8: 120,872,132 (GRCm39) T20I probably benign Het
Adamts2 C T 11: 50,679,516 (GRCm39) T832I possibly damaging Het
Agbl1 G A 7: 76,239,298 (GRCm39) probably null Het
Ankrd61 T C 5: 143,833,894 (GRCm39) probably benign Het
Anpep T G 7: 79,488,039 (GRCm39) Y506S possibly damaging Het
Aox1 T A 1: 58,382,832 (GRCm39) H1037Q probably benign Het
Auh G A 13: 53,052,755 (GRCm39) R47* probably null Het
B4galt5 T A 2: 167,148,558 (GRCm39) M187L probably benign Het
Bub1 A T 2: 127,643,343 (GRCm39) D1000E probably benign Het
Cacna1f T G X: 7,492,687 (GRCm39) probably null Het
Cdh3 T C 8: 107,279,039 (GRCm39) L667P probably damaging Het
Cenpe A T 3: 134,946,834 (GRCm39) R1116S possibly damaging Het
Ces1b T A 8: 93,799,969 (GRCm39) M136L possibly damaging Het
Cfap54 T C 10: 92,833,236 (GRCm39) E1130G possibly damaging Het
Chd9 C T 8: 91,760,615 (GRCm39) P2120L probably benign Het
Clu T C 14: 66,212,452 (GRCm39) V135A probably damaging Het
Cmip T A 8: 118,163,432 (GRCm39) S388T probably benign Het
Cnga1 C T 5: 72,776,404 (GRCm39) V20I possibly damaging Het
Cox4i1 T A 8: 121,400,029 (GRCm39) V51E possibly damaging Het
Crym T C 7: 119,801,050 (GRCm39) N33S probably benign Het
Ctcf T A 8: 106,398,016 (GRCm39) V434E probably damaging Het
Daam1 G A 12: 72,021,997 (GRCm39) D732N probably damaging Het
Dcaf13 A G 15: 39,008,547 (GRCm39) Y383C probably benign Het
Dock2 T C 11: 34,262,485 (GRCm39) T957A probably benign Het
Duox1 A G 2: 122,163,619 (GRCm39) D817G probably benign Het
Eif1ad16 T C 12: 87,985,258 (GRCm39) Y95C probably damaging Het
Fads3 A G 19: 10,033,818 (GRCm39) Y401C probably damaging Het
Fam72a T C 1: 131,456,592 (GRCm39) probably null Het
Fbxw21 C A 9: 108,974,553 (GRCm39) K322N probably benign Het
Fdxr G A 11: 115,162,806 (GRCm39) T100I probably damaging Het
Galnt11 C G 5: 25,452,610 (GRCm39) P41A probably damaging Het
Glb1l T C 1: 75,178,473 (GRCm39) T322A probably damaging Het
Gm6871 T A 7: 41,197,414 (GRCm39) T149S probably benign Het
Gpr26 C T 7: 131,568,823 (GRCm39) T56I probably damaging Het
Grik4 C A 9: 42,533,438 (GRCm39) G361C probably damaging Het
Gsr T G 8: 34,170,316 (GRCm39) D200E probably benign Het
Igsf5 T A 16: 96,165,247 (GRCm39) D7E probably benign Het
Inpp5e T A 2: 26,289,355 (GRCm39) I522F probably damaging Het
Insm2 C A 12: 55,647,096 (GRCm39) T280K probably benign Het
Itih4 T C 14: 30,617,435 (GRCm39) V585A probably damaging Het
Katnip T A 7: 125,394,515 (GRCm39) V197D probably benign Het
Knl1 A T 2: 118,888,849 (GRCm39) R17* probably null Het
Lag3 G T 6: 124,888,272 (GRCm39) L15I possibly damaging Het
Lepr T A 4: 101,648,093 (GRCm39) S861T probably damaging Het
Mcur1 A T 13: 43,697,941 (GRCm39) Y320N probably damaging Het
Mgam A T 6: 40,736,717 (GRCm39) D872V probably damaging Het
Mlycd T C 8: 120,134,446 (GRCm39) probably null Het
Mpl C A 4: 118,312,954 (GRCm39) C193F probably damaging Het
Mycbp2 C A 14: 103,368,681 (GRCm39) A4142S probably damaging Het
Myh1 T A 11: 67,104,424 (GRCm39) D993E possibly damaging Het
N4bp2 T A 5: 65,947,404 (GRCm39) D11E probably benign Het
Neb T C 2: 52,085,533 (GRCm39) I1521V probably benign Het
Notch1 A G 2: 26,355,485 (GRCm39) V1744A possibly damaging Het
Numa1 T C 7: 101,644,731 (GRCm39) S236P possibly damaging Het
Or4p20 T C 2: 88,253,800 (GRCm39) T190A possibly damaging Het
Or6c66 T A 10: 129,461,784 (GRCm39) I49L probably benign Het
Or8k23 A G 2: 86,186,708 (GRCm39) L6P possibly damaging Het
Otogl A G 10: 107,710,361 (GRCm39) L576P probably damaging Het
P2ry1 C T 3: 60,910,900 (GRCm39) T13M probably damaging Het
Pak6 A T 2: 118,525,050 (GRCm39) R559* probably null Het
Parvb A T 15: 84,182,171 (GRCm39) M234L probably benign Het
Pcdha11 T C 18: 37,145,907 (GRCm39) V666A possibly damaging Het
Pde3b T A 7: 114,126,092 (GRCm39) Y775* probably null Het
Pgam5 A G 5: 110,413,869 (GRCm39) L98P probably damaging Het
Phip T C 9: 82,797,392 (GRCm39) H537R possibly damaging Het
Pkib T G 10: 57,604,205 (GRCm39) D4E probably damaging Het
Plcb1 A T 2: 135,102,428 (GRCm39) I202F probably benign Het
Pold3 A G 7: 99,770,590 (GRCm39) V14A probably damaging Het
Prdm1 T A 10: 44,322,803 (GRCm39) T249S probably benign Het
Prpf39 T A 12: 65,104,589 (GRCm39) F551L probably benign Het
Prune2 A G 19: 17,099,986 (GRCm39) E1830G probably benign Het
Ralgapa1 G A 12: 55,764,986 (GRCm39) P889S probably damaging Het
Rassf2 A T 2: 131,840,163 (GRCm39) probably null Het
Rnf185 A G 11: 3,368,067 (GRCm39) Y204H probably benign Het
Rpap1 A G 2: 119,610,535 (GRCm39) probably null Het
Rufy3 T C 5: 88,797,757 (GRCm39) S645P probably damaging Het
Senp7 T A 16: 55,971,725 (GRCm39) H287Q probably benign Het
Sgsm3 T C 15: 80,888,073 (GRCm39) probably null Het
Slc25a11 A T 11: 70,536,658 (GRCm39) V104E possibly damaging Het
Slc25a13 G A 6: 6,117,190 (GRCm39) T175I probably benign Het
Slc26a3 T A 12: 31,520,902 (GRCm39) F702Y probably damaging Het
Smco2 T A 6: 146,761,465 (GRCm39) L184H probably damaging Het
Ssc4d A T 5: 135,994,461 (GRCm39) C90S probably damaging Het
Sspo T C 6: 48,441,298 (GRCm39) S1835P probably damaging Het
Stk35 A G 2: 129,643,435 (GRCm39) T140A probably damaging Het
Syngr1 C T 15: 79,995,941 (GRCm39) T160M probably damaging Het
Tent2 A G 13: 93,320,726 (GRCm39) L109S probably damaging Het
Tgfb1i1 A G 7: 127,848,085 (GRCm39) probably null Het
Thoc1 T A 18: 9,977,947 (GRCm39) V296E probably damaging Het
Timp2 C T 11: 118,201,412 (GRCm39) C75Y probably damaging Het
Tlr1 T C 5: 65,082,639 (GRCm39) Y646C probably damaging Het
Tprn G A 2: 25,158,940 (GRCm39) E655K possibly damaging Het
Trbv14 A C 6: 41,112,424 (GRCm39) I74L probably benign Het
Trbv5 T A 6: 41,039,555 (GRCm39) Y53* probably null Het
Trpm5 T C 7: 142,642,656 (GRCm39) Q97R possibly damaging Het
Tut1 A G 19: 8,932,931 (GRCm39) D88G probably damaging Het
Ucp2 A T 7: 100,147,620 (GRCm39) I200F probably benign Het
Unc45a G A 7: 79,988,623 (GRCm39) S131L probably benign Het
Uty A T Y: 1,158,182 (GRCm39) H573Q probably damaging Het
Vmn1r17 T A 6: 57,337,855 (GRCm39) Y121F possibly damaging Het
Vmn1r53 T C 6: 90,200,554 (GRCm39) I257V probably benign Het
Vmn2r90 C T 17: 17,954,229 (GRCm39) L798F probably damaging Het
Vmn2r94 A T 17: 18,477,736 (GRCm39) M225K probably benign Het
Wdr24 A T 17: 26,043,273 (GRCm39) I32F possibly damaging Het
Zc3h11a T A 1: 133,552,521 (GRCm39) T529S probably benign Het
Zc3h4 A G 7: 16,168,264 (GRCm39) H791R unknown Het
Zfp24 A G 18: 24,150,927 (GRCm39) L73P probably damaging Het
Zfp616 T C 11: 73,974,121 (GRCm39) I130T probably benign Het
Zim1 ACAGCAG ACAGCAGCAG 7: 6,680,429 (GRCm39) probably benign Het
Zim1 CAG CAGAAG 7: 6,680,430 (GRCm39) probably benign Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119,599,572 (GRCm39) missense probably benign 0.00
IGL00272:Scn11a APN 9 119,645,669 (GRCm39) missense probably damaging 0.98
IGL00332:Scn11a APN 9 119,598,982 (GRCm39) missense probably damaging 1.00
IGL00533:Scn11a APN 9 119,603,447 (GRCm39) missense probably damaging 1.00
IGL00972:Scn11a APN 9 119,623,004 (GRCm39) missense probably benign 0.44
IGL01338:Scn11a APN 9 119,613,227 (GRCm39) splice site probably benign
IGL01534:Scn11a APN 9 119,609,888 (GRCm39) missense probably benign 0.27
IGL01838:Scn11a APN 9 119,587,649 (GRCm39) missense probably damaging 1.00
IGL01991:Scn11a APN 9 119,648,970 (GRCm39) missense probably damaging 0.97
IGL02057:Scn11a APN 9 119,594,536 (GRCm39) missense probably damaging 1.00
IGL02290:Scn11a APN 9 119,603,508 (GRCm39) missense probably damaging 0.97
IGL02454:Scn11a APN 9 119,587,610 (GRCm39) missense probably benign 0.00
IGL02517:Scn11a APN 9 119,621,464 (GRCm39) missense probably damaging 1.00
IGL02567:Scn11a APN 9 119,633,555 (GRCm39) missense probably damaging 0.99
IGL02587:Scn11a APN 9 119,634,750 (GRCm39) missense probably damaging 1.00
IGL03069:Scn11a APN 9 119,619,029 (GRCm39) missense probably benign 0.16
IGL03171:Scn11a APN 9 119,648,913 (GRCm39) missense probably benign 0.00
Kleinie UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
H8441:Scn11a UTSW 9 119,636,976 (GRCm39) missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119,599,014 (GRCm39) missense probably damaging 1.00
R0304:Scn11a UTSW 9 119,648,928 (GRCm39) missense probably benign 0.00
R0519:Scn11a UTSW 9 119,619,185 (GRCm39) missense probably damaging 1.00
R0658:Scn11a UTSW 9 119,640,226 (GRCm39) missense probably benign 0.41
R0828:Scn11a UTSW 9 119,584,073 (GRCm39) missense probably benign 0.00
R0893:Scn11a UTSW 9 119,632,396 (GRCm39) splice site probably null
R0932:Scn11a UTSW 9 119,636,876 (GRCm39) missense probably damaging 1.00
R1061:Scn11a UTSW 9 119,624,729 (GRCm39) missense probably damaging 0.98
R1161:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1162:Scn11a UTSW 9 119,634,710 (GRCm39) splice site probably benign
R1310:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1589:Scn11a UTSW 9 119,598,873 (GRCm39) missense probably damaging 1.00
R1681:Scn11a UTSW 9 119,633,478 (GRCm39) missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119,584,148 (GRCm39) missense probably damaging 1.00
R1812:Scn11a UTSW 9 119,609,931 (GRCm39) nonsense probably null
R1901:Scn11a UTSW 9 119,608,102 (GRCm39) nonsense probably null
R1978:Scn11a UTSW 9 119,609,861 (GRCm39) nonsense probably null
R1985:Scn11a UTSW 9 119,583,744 (GRCm39) missense probably benign 0.19
R2022:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119,621,560 (GRCm39) missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119,584,091 (GRCm39) missense probably damaging 1.00
R2250:Scn11a UTSW 9 119,587,668 (GRCm39) missense probably benign 0.01
R2373:Scn11a UTSW 9 119,642,252 (GRCm39) missense probably benign 0.43
R3757:Scn11a UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
R3767:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R3770:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R4089:Scn11a UTSW 9 119,624,719 (GRCm39) splice site probably null
R4092:Scn11a UTSW 9 119,619,036 (GRCm39) missense probably benign 0.03
R4247:Scn11a UTSW 9 119,636,952 (GRCm39) missense probably damaging 1.00
R4279:Scn11a UTSW 9 119,583,428 (GRCm39) missense probably benign 0.25
R4299:Scn11a UTSW 9 119,594,572 (GRCm39) missense probably damaging 0.97
R4403:Scn11a UTSW 9 119,624,733 (GRCm39) missense probably damaging 1.00
R4468:Scn11a UTSW 9 119,584,053 (GRCm39) missense probably damaging 1.00
R4542:Scn11a UTSW 9 119,584,200 (GRCm39) missense probably damaging 1.00
R4644:Scn11a UTSW 9 119,644,269 (GRCm39) splice site probably null
R4739:Scn11a UTSW 9 119,583,627 (GRCm39) missense probably benign 0.39
R4809:Scn11a UTSW 9 119,648,936 (GRCm39) missense probably benign 0.00
R4954:Scn11a UTSW 9 119,587,725 (GRCm39) missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119,609,944 (GRCm39) missense probably benign 0.31
R5044:Scn11a UTSW 9 119,648,897 (GRCm39) missense probably damaging 0.98
R5222:Scn11a UTSW 9 119,644,268 (GRCm39) splice site probably null
R5224:Scn11a UTSW 9 119,583,858 (GRCm39) missense probably damaging 1.00
R5400:Scn11a UTSW 9 119,598,974 (GRCm39) missense probably damaging 0.97
R5555:Scn11a UTSW 9 119,584,304 (GRCm39) missense probably damaging 1.00
R5711:Scn11a UTSW 9 119,618,990 (GRCm39) missense probably damaging 1.00
R5950:Scn11a UTSW 9 119,640,190 (GRCm39) missense probably damaging 1.00
R5984:Scn11a UTSW 9 119,613,082 (GRCm39) missense probably benign
R6057:Scn11a UTSW 9 119,594,514 (GRCm39) missense probably damaging 1.00
R6104:Scn11a UTSW 9 119,624,744 (GRCm39) missense probably damaging 1.00
R6180:Scn11a UTSW 9 119,583,933 (GRCm39) missense probably benign 0.00
R6892:Scn11a UTSW 9 119,636,035 (GRCm39) missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119,621,492 (GRCm39) missense probably damaging 1.00
R6949:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably benign 0.04
R7112:Scn11a UTSW 9 119,583,875 (GRCm39) missense probably damaging 1.00
R7232:Scn11a UTSW 9 119,588,982 (GRCm39) missense probably damaging 1.00
R7261:Scn11a UTSW 9 119,648,899 (GRCm39) missense probably damaging 0.99
R7265:Scn11a UTSW 9 119,644,331 (GRCm39) missense probably damaging 1.00
R7302:Scn11a UTSW 9 119,636,017 (GRCm39) missense probably benign 0.03
R7391:Scn11a UTSW 9 119,624,783 (GRCm39) missense probably damaging 1.00
R7441:Scn11a UTSW 9 119,587,692 (GRCm39) missense probably benign 0.01
R7479:Scn11a UTSW 9 119,588,941 (GRCm39) missense probably benign 0.38
R7608:Scn11a UTSW 9 119,644,379 (GRCm39) splice site probably null
R7768:Scn11a UTSW 9 119,644,338 (GRCm39) missense probably benign 0.13
R7785:Scn11a UTSW 9 119,645,622 (GRCm39) missense probably benign 0.00
R7794:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably damaging 0.99
R7818:Scn11a UTSW 9 119,613,177 (GRCm39) missense probably damaging 0.97
R7884:Scn11a UTSW 9 119,633,617 (GRCm39) missense probably benign 0.01
R7988:Scn11a UTSW 9 119,594,503 (GRCm39) missense probably damaging 0.97
R8049:Scn11a UTSW 9 119,584,149 (GRCm39) missense probably damaging 1.00
R8127:Scn11a UTSW 9 119,633,578 (GRCm39) missense probably damaging 1.00
R8274:Scn11a UTSW 9 119,632,548 (GRCm39) missense probably benign
R8344:Scn11a UTSW 9 119,611,036 (GRCm39) missense probably benign 0.00
R8346:Scn11a UTSW 9 119,608,047 (GRCm39) missense probably damaging 1.00
R8511:Scn11a UTSW 9 119,618,981 (GRCm39) missense probably damaging 0.99
R8819:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8820:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8837:Scn11a UTSW 9 119,621,410 (GRCm39) missense probably damaging 1.00
R8913:Scn11a UTSW 9 119,623,094 (GRCm39) missense probably damaging 1.00
R8915:Scn11a UTSW 9 119,603,363 (GRCm39) nonsense probably null
R8975:Scn11a UTSW 9 119,587,565 (GRCm39) missense probably damaging 1.00
R9156:Scn11a UTSW 9 119,588,989 (GRCm39) missense possibly damaging 0.75
R9222:Scn11a UTSW 9 119,611,013 (GRCm39) missense probably damaging 0.98
R9355:Scn11a UTSW 9 119,584,160 (GRCm39) missense probably damaging 1.00
R9486:Scn11a UTSW 9 119,624,774 (GRCm39) missense possibly damaging 0.86
R9712:Scn11a UTSW 9 119,619,076 (GRCm39) nonsense probably null
R9766:Scn11a UTSW 9 119,584,181 (GRCm39) missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119,584,308 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,648,886 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,584,064 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ATTAGCATCACATTCCCTGCAAG -3'
(R):5'- ATGTGCATCTGGAGCTTAGC -3'

Sequencing Primer
(F):5'- ACATTCCCTGCAAGCATTGG -3'
(R):5'- CATCTGGAGCTTAGCAAGGGACC -3'
Posted On 2014-12-04