Incidental Mutation 'R2846:Cdnf'
ID251567
Institutional Source Beutler Lab
Gene Symbol Cdnf
Ensembl Gene ENSMUSG00000039496
Gene Namecerebral dopamine neurotrophic factor
SynonymsArmetl1
MMRRC Submission 040439-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.039) question?
Stock #R2846 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location3513030-3526376 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 3513128 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000046297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027961] [ENSMUST00000036350] [ENSMUST00000124331] [ENSMUST00000140494]
Predicted Effect probably benign
Transcript: ENSMUST00000027961
SMART Domains Protein: ENSMUSP00000027961
Gene: ENSMUSG00000109865

DomainStartEndE-ValueType
Pfam:HSP70 3 509 6.3e-115 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000036350
AA Change: M1K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046297
Gene: ENSMUSG00000039496
AA Change: M1K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Armet 36 181 2.6e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124331
SMART Domains Protein: ENSMUSP00000119850
Gene: ENSMUSG00000051396

DomainStartEndE-ValueType
Pfam:HSP70 3 74 1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132566
Predicted Effect probably benign
Transcript: ENSMUST00000140494
SMART Domains Protein: ENSMUSP00000120385
Gene: ENSMUSG00000051396

DomainStartEndE-ValueType
Pfam:HSP70 3 88 1.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148167
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg4a G A X: 140,992,840 E106K probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Ddx4 T A 13: 112,604,612 K496M probably damaging Het
Dlg1 T C 16: 31,863,197 S779P probably damaging Het
Dtna T A 18: 23,651,503 probably null Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Gal3st2c A T 1: 93,996,400 Q8L possibly damaging Het
Hsd3b1 T C 3: 98,852,778 E299G probably damaging Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Irs4 C A X: 141,724,340 G287W probably damaging Het
Kif21a T C 15: 90,934,464 I1570V probably benign Het
Kremen1 GG GGGCG 11: 5,201,793 probably benign Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mindy4 T C 6: 55,278,100 V521A probably damaging Het
Olfr119 T C 17: 37,700,823 I51T probably damaging Het
Olfr384 A T 11: 73,603,383 T268S probably benign Het
Pdgfrb C T 18: 61,064,016 P175S probably benign Het
Pign C A 1: 105,657,796 L9F possibly damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Ppfia3 C A 7: 45,356,428 R348L probably damaging Het
Prr12 G C 7: 45,046,012 S1343R unknown Het
Psmd13 C A 7: 140,897,740 probably benign Het
Qpct A G 17: 79,070,742 T114A probably damaging Het
Sec24d A G 3: 123,350,746 D624G probably damaging Het
Shank2 A G 7: 144,070,055 Y259C probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Smarcb1 C A 10: 75,897,541 R332L probably damaging Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
St18 T A 1: 6,845,587 C819S probably damaging Het
Tas2r124 A G 6: 132,755,267 N180D possibly damaging Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Tmem204 G A 17: 25,080,333 H71Y probably benign Het
Vmn1r212 A G 13: 22,884,092 S24P probably damaging Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zmiz1 A G 14: 25,645,675 S259G probably benign Het
Other mutations in Cdnf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Cdnf APN 2 3519355 missense possibly damaging 0.73
IGL02552:Cdnf APN 2 3523975 nonsense probably null
IGL03390:Cdnf APN 2 3523826 nonsense probably null
R1528:Cdnf UTSW 2 3521041 missense probably damaging 1.00
R4077:Cdnf UTSW 2 3521023 missense probably damaging 1.00
Z1177:Cdnf UTSW 2 3521083 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- AGTTTTAGCGCATCACTCCG -3'
(R):5'- TTAGGCAATTGCTAGGCTGAGC -3'

Sequencing Primer
(F):5'- TAAACGCCGGTCTGCTCAAG -3'
(R):5'- TAGGCTGAGCGCGGTGTC -3'
Posted On2014-12-04