Incidental Mutation 'R0309:Ehbp1l1'
ID 25157
Institutional Source Beutler Lab
Gene Symbol Ehbp1l1
Ensembl Gene ENSMUSG00000024937
Gene Name EH domain binding protein 1-like 1
Synonyms G430002G23Rik
MMRRC Submission 038519-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0309 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 5757404-5776345 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 5770598 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 287 (E287G)
Ref Sequence ENSEMBL: ENSMUSP00000037656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049295] [ENSMUST00000075606]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000049295
AA Change: E287G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000037656
Gene: ENSMUSG00000024937
AA Change: E287G

DomainStartEndE-ValueType
Pfam:NT-C2 12 164 3.2e-24 PFAM
low complexity region 245 256 N/A INTRINSIC
low complexity region 276 291 N/A INTRINSIC
internal_repeat_1 442 821 1.71e-12 PROSPERO
internal_repeat_1 833 1197 1.71e-12 PROSPERO
CH 1212 1310 3.55e-16 SMART
low complexity region 1316 1331 N/A INTRINSIC
low complexity region 1426 1449 N/A INTRINSIC
low complexity region 1471 1484 N/A INTRINSIC
low complexity region 1493 1547 N/A INTRINSIC
DUF3585 1552 1696 6.7e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075606
SMART Domains Protein: ENSMUSP00000126740
Gene: ENSMUSG00000024937

DomainStartEndE-ValueType
Pfam:NT-C2 12 164 3.9e-25 PFAM
CH 268 366 3.55e-16 SMART
low complexity region 372 387 N/A INTRINSIC
low complexity region 482 505 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 549 603 N/A INTRINSIC
DUF3585 608 752 6.7e-59 SMART
Meta Mutation Damage Score 0.1033 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.6%
  • 10x: 94.3%
  • 20x: 86.4%
Validation Efficiency 98% (125/127)
MGI Phenotype PHENOTYPE: Homozygous knockout leads to a reduction in the length and density of small intestinal microvilli, severe anemia, and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 126 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik T C 2: 35,266,271 (GRCm39) D133G possibly damaging Het
Abcb4 A C 5: 8,989,835 (GRCm39) D796A probably damaging Het
Actg2 A T 6: 83,496,896 (GRCm39) V147E probably damaging Het
Adamts13 A C 2: 26,877,001 (GRCm39) T534P probably damaging Het
Ago1 T C 4: 126,336,959 (GRCm39) T249A probably benign Het
Ahnak T A 19: 8,979,859 (GRCm39) I381N probably damaging Het
Akap9 A G 5: 4,119,038 (GRCm39) D3515G probably benign Het
Angptl3 T C 4: 98,922,706 (GRCm39) V249A probably benign Het
Ank A G 15: 27,567,658 (GRCm39) T294A possibly damaging Het
Ank1 A T 8: 23,594,825 (GRCm39) H204L probably damaging Het
Apbb2 A G 5: 66,468,331 (GRCm39) probably benign Het
Arhgap28 A T 17: 68,208,424 (GRCm39) S15T probably benign Het
Aspm T C 1: 139,410,249 (GRCm39) probably benign Het
Atp1a4 T C 1: 172,062,554 (GRCm39) E651G probably damaging Het
B3gnt2 A T 11: 22,786,860 (GRCm39) F109L probably damaging Het
Bpifb4 T C 2: 153,801,603 (GRCm39) F575L probably damaging Het
Calhm4 A G 10: 33,920,043 (GRCm39) W75R probably damaging Het
Calr C A 8: 85,569,660 (GRCm39) K322N probably benign Het
Ccdc188 T C 16: 18,037,169 (GRCm39) S247P possibly damaging Het
Cdr1 T A X: 60,228,908 (GRCm39) D86V unknown Het
Cep97 C T 16: 55,745,421 (GRCm39) V48I probably damaging Het
Chaf1b T A 16: 93,681,399 (GRCm39) C6S probably damaging Het
Chd3 C T 11: 69,247,844 (GRCm39) D920N probably damaging Het
Clk1 T C 1: 58,452,192 (GRCm39) probably benign Het
Cntnap3 T A 13: 64,905,250 (GRCm39) probably benign Het
Col12a1 T A 9: 79,507,293 (GRCm39) probably null Het
Col17a1 G T 19: 47,659,801 (GRCm39) probably benign Het
Coq7 T A 7: 118,128,940 (GRCm39) I32F possibly damaging Het
Cox6a2 A T 7: 127,805,107 (GRCm39) F59I probably damaging Het
Cpq A G 15: 33,594,297 (GRCm39) D436G probably damaging Het
Ctso G A 3: 81,852,168 (GRCm39) probably null Het
Cxadr A T 16: 78,131,836 (GRCm39) H274L probably benign Het
Cyp2c40 A T 19: 39,766,495 (GRCm39) C367S possibly damaging Het
Cyp2c70 T G 19: 40,149,115 (GRCm39) M344L possibly damaging Het
Defa35 G A 8: 21,555,871 (GRCm39) V77I probably benign Het
Dhx57 A G 17: 80,582,310 (GRCm39) Y432H probably damaging Het
Dhx9 A T 1: 153,341,441 (GRCm39) D601E probably benign Het
Dnah7a C G 1: 53,444,849 (GRCm39) D3952H probably damaging Het
Dnah9 C A 11: 65,917,798 (GRCm39) probably benign Het
Dstyk C A 1: 132,384,602 (GRCm39) probably benign Het
Efcab2 T A 1: 178,303,469 (GRCm39) probably benign Het
Epgn A G 5: 91,180,073 (GRCm39) T87A probably benign Het
Erc2 A C 14: 27,863,182 (GRCm39) E803A probably damaging Het
Fer A G 17: 64,446,011 (GRCm39) *454W probably null Het
Glyr1 T C 16: 4,849,836 (GRCm39) D179G probably damaging Het
Gm12830 T A 4: 114,702,173 (GRCm39) probably benign Het
Gm9922 C A 14: 101,967,129 (GRCm39) probably benign Het
Gsta3 C T 1: 21,335,118 (GRCm39) P200S possibly damaging Het
Hmgxb3 G A 18: 61,288,200 (GRCm39) probably benign Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Il16 T C 7: 83,371,762 (GRCm39) K15E probably damaging Het
Kcnip2 T A 19: 45,782,514 (GRCm39) probably benign Het
Kdm4c T C 4: 74,263,804 (GRCm39) V696A probably benign Het
Kdr A G 5: 76,107,587 (GRCm39) probably benign Het
Klhl33 T G 14: 51,128,868 (GRCm39) H787P probably damaging Het
Klk14 A T 7: 43,343,769 (GRCm39) T159S probably benign Het
Lancl2 A G 6: 57,680,117 (GRCm39) N16D probably damaging Het
Lemd3 T C 10: 120,773,015 (GRCm39) N583S possibly damaging Het
Map3k4 TGCTGGCTTCAGGGCCACAGTCCGCTG TGCTG 17: 12,489,902 (GRCm39) probably null Het
Mpl T G 4: 118,303,235 (GRCm39) probably benign Het
Myh7b T C 2: 155,472,592 (GRCm39) probably benign Het
Mylk A C 16: 34,732,667 (GRCm39) probably benign Het
Myof A T 19: 37,969,714 (GRCm39) M316K probably benign Het
Nfib T A 4: 82,214,974 (GRCm39) N543I probably damaging Het
Nfix A G 8: 85,448,403 (GRCm39) S375P probably damaging Het
Nkrf T C X: 36,153,769 (GRCm39) Q171R probably damaging Het
Nmnat2 T A 1: 152,952,747 (GRCm39) probably benign Het
Npffr2 G A 5: 89,731,206 (GRCm39) E379K probably benign Het
Npr2 T C 4: 43,640,904 (GRCm39) probably benign Het
Nup98 A C 7: 101,801,635 (GRCm39) D212E probably null Het
Nwd2 T C 5: 63,964,561 (GRCm39) Y1382H probably damaging Het
Ocstamp T C 2: 165,237,912 (GRCm39) R451G possibly damaging Het
Or52s1 T A 7: 102,861,928 (GRCm39) I287K probably damaging Het
Or6c6c A G 10: 129,541,008 (GRCm39) D87G probably benign Het
Pabpc1 C T 15: 36,597,737 (GRCm39) A551T possibly damaging Het
Pard3 A T 8: 128,103,378 (GRCm39) probably benign Het
Pcdhb12 G T 18: 37,569,174 (GRCm39) V107L probably benign Het
Pik3cd A T 4: 149,747,677 (GRCm39) V22D probably damaging Het
Pkd1l2 A G 8: 117,724,315 (GRCm39) V2396A probably damaging Het
Pnpla7 T C 2: 24,877,207 (GRCm39) I167T probably damaging Het
Pphln1 A T 15: 93,339,588 (GRCm39) H114L possibly damaging Het
Ppm1h A G 10: 122,756,687 (GRCm39) N444S probably damaging Het
Prdm9 G A 17: 15,777,646 (GRCm39) T146I probably damaging Het
Prrc2a A G 17: 35,369,891 (GRCm39) probably benign Het
Prrx1 T C 1: 163,140,128 (GRCm39) D26G possibly damaging Het
Ptpn5 T C 7: 46,729,042 (GRCm39) E495G probably damaging Het
Rab23 A C 1: 33,773,942 (GRCm39) probably null Het
Ralgps1 C T 2: 33,047,935 (GRCm39) M348I probably benign Het
Ranbp2 A G 10: 58,315,690 (GRCm39) T2137A probably benign Het
Rapgef4 G T 2: 72,056,374 (GRCm39) G654V probably benign Het
Rc3h2 A T 2: 37,269,020 (GRCm39) probably benign Het
Reg2 G A 6: 78,383,169 (GRCm39) A39T possibly damaging Het
Sema4d C A 13: 51,879,347 (GRCm39) V7F probably benign Het
Sgip1 T C 4: 102,772,354 (GRCm39) probably benign Het
Sgpl1 C T 10: 60,949,216 (GRCm39) probably null Het
Shisa9 G A 16: 11,814,987 (GRCm39) V212M probably damaging Het
Shq1 G A 6: 100,550,588 (GRCm39) P450L probably benign Het
Sin3a A G 9: 57,018,196 (GRCm39) T872A probably benign Het
Sipa1l3 C T 7: 29,047,775 (GRCm39) R1371Q probably benign Het
Skint8 T C 4: 111,796,064 (GRCm39) V246A probably benign Het
Slc22a20 A T 19: 6,022,985 (GRCm39) V386D probably damaging Het
Slc28a2b A T 2: 122,348,034 (GRCm39) T253S probably benign Het
Slc2a7 G A 4: 150,242,528 (GRCm39) probably benign Het
Slc35a2 T A X: 7,755,901 (GRCm39) Y48N probably damaging Het
Slc4a2 G T 5: 24,639,344 (GRCm39) S413I probably damaging Het
Sntg2 T C 12: 30,276,772 (GRCm39) T427A probably benign Het
Soat1 T C 1: 156,270,023 (GRCm39) Y132C probably damaging Het
Stn1 G T 19: 47,490,112 (GRCm39) H342N probably benign Het
Tarbp1 T A 8: 127,165,667 (GRCm39) probably benign Het
Tas2r113 A C 6: 132,870,341 (GRCm39) K123T probably damaging Het
Tbck C T 3: 132,440,168 (GRCm39) Q504* probably null Het
Tenm3 C T 8: 48,794,069 (GRCm39) C380Y probably damaging Het
Tent4a A T 13: 69,648,051 (GRCm39) V781E possibly damaging Het
Triobp A G 15: 78,860,740 (GRCm39) D1389G probably damaging Het
Trpm4 A T 7: 44,958,130 (GRCm39) F780I probably damaging Het
Tubb4a G T 17: 57,388,182 (GRCm39) Y281* probably null Het
Txndc15 T C 13: 55,872,395 (GRCm39) F261S probably damaging Het
Ube3b T C 5: 114,557,530 (GRCm39) probably benign Het
Unc5c G C 3: 141,439,694 (GRCm39) V196L probably benign Het
Upf3a G A 8: 13,845,500 (GRCm39) probably null Het
Vmn2r20 T C 6: 123,363,063 (GRCm39) K574E probably benign Het
Vps50 A G 6: 3,536,853 (GRCm39) M275V possibly damaging Het
Xrcc5 A G 1: 72,346,735 (GRCm39) probably benign Het
Zbtb18 T C 1: 177,276,182 (GRCm39) L505S probably damaging Het
Zbtb41 T C 1: 139,366,722 (GRCm39) I567T probably damaging Het
Zfp598 T C 17: 24,897,558 (GRCm39) probably benign Het
Other mutations in Ehbp1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Ehbp1l1 APN 19 5,767,961 (GRCm39) missense probably benign 0.33
IGL01061:Ehbp1l1 APN 19 5,767,916 (GRCm39) missense probably benign
IGL01372:Ehbp1l1 APN 19 5,765,817 (GRCm39) splice site probably benign
IGL01790:Ehbp1l1 APN 19 5,773,012 (GRCm39) missense probably damaging 0.99
IGL01936:Ehbp1l1 APN 19 5,768,277 (GRCm39) nonsense probably null
IGL02194:Ehbp1l1 APN 19 5,768,885 (GRCm39) missense probably benign
IGL02347:Ehbp1l1 APN 19 5,769,600 (GRCm39) missense possibly damaging 0.72
IGL02372:Ehbp1l1 APN 19 5,760,862 (GRCm39) missense possibly damaging 0.53
IGL02681:Ehbp1l1 APN 19 5,770,853 (GRCm39) missense probably damaging 0.98
IGL02824:Ehbp1l1 APN 19 5,769,326 (GRCm39) missense probably benign
IGL03070:Ehbp1l1 APN 19 5,765,981 (GRCm39) missense probably benign 0.33
IGL03146:Ehbp1l1 APN 19 5,770,061 (GRCm39) missense probably benign 0.00
PIT4802001:Ehbp1l1 UTSW 19 5,769,603 (GRCm39) missense possibly damaging 0.93
R0787:Ehbp1l1 UTSW 19 5,772,696 (GRCm39) missense possibly damaging 0.95
R1156:Ehbp1l1 UTSW 19 5,758,364 (GRCm39) unclassified probably benign
R1337:Ehbp1l1 UTSW 19 5,768,258 (GRCm39) missense probably benign 0.00
R1474:Ehbp1l1 UTSW 19 5,769,112 (GRCm39) missense possibly damaging 0.86
R1501:Ehbp1l1 UTSW 19 5,766,452 (GRCm39) missense probably damaging 0.98
R1582:Ehbp1l1 UTSW 19 5,771,995 (GRCm39) missense possibly damaging 0.83
R1766:Ehbp1l1 UTSW 19 5,766,434 (GRCm39) missense probably damaging 0.98
R1838:Ehbp1l1 UTSW 19 5,767,719 (GRCm39) missense probably benign 0.39
R1842:Ehbp1l1 UTSW 19 5,775,958 (GRCm39) missense probably damaging 0.99
R1863:Ehbp1l1 UTSW 19 5,767,882 (GRCm39) missense probably benign 0.01
R1955:Ehbp1l1 UTSW 19 5,760,697 (GRCm39) missense possibly damaging 0.51
R2010:Ehbp1l1 UTSW 19 5,769,311 (GRCm39) missense probably benign
R2098:Ehbp1l1 UTSW 19 5,758,686 (GRCm39) missense possibly damaging 0.93
R2099:Ehbp1l1 UTSW 19 5,768,429 (GRCm39) missense possibly damaging 0.72
R2852:Ehbp1l1 UTSW 19 5,766,515 (GRCm39) missense probably damaging 0.99
R3113:Ehbp1l1 UTSW 19 5,769,008 (GRCm39) missense probably benign 0.38
R3799:Ehbp1l1 UTSW 19 5,769,143 (GRCm39) missense probably benign 0.33
R3891:Ehbp1l1 UTSW 19 5,768,340 (GRCm39) missense possibly damaging 0.73
R3964:Ehbp1l1 UTSW 19 5,760,601 (GRCm39) critical splice donor site probably null
R3966:Ehbp1l1 UTSW 19 5,760,601 (GRCm39) critical splice donor site probably null
R4335:Ehbp1l1 UTSW 19 5,758,797 (GRCm39) missense probably damaging 0.98
R4434:Ehbp1l1 UTSW 19 5,766,276 (GRCm39) missense possibly damaging 0.93
R4457:Ehbp1l1 UTSW 19 5,766,321 (GRCm39) missense possibly damaging 0.83
R4597:Ehbp1l1 UTSW 19 5,767,955 (GRCm39) missense possibly damaging 0.72
R4726:Ehbp1l1 UTSW 19 5,769,204 (GRCm39) missense possibly damaging 0.70
R4761:Ehbp1l1 UTSW 19 5,769,875 (GRCm39) missense possibly damaging 0.93
R4771:Ehbp1l1 UTSW 19 5,775,996 (GRCm39) missense probably damaging 1.00
R5402:Ehbp1l1 UTSW 19 5,766,348 (GRCm39) missense possibly damaging 0.91
R5436:Ehbp1l1 UTSW 19 5,766,276 (GRCm39) missense possibly damaging 0.93
R5602:Ehbp1l1 UTSW 19 5,758,698 (GRCm39) missense possibly damaging 0.85
R5893:Ehbp1l1 UTSW 19 5,768,459 (GRCm39) missense probably benign
R6329:Ehbp1l1 UTSW 19 5,768,795 (GRCm39) missense possibly damaging 0.53
R6416:Ehbp1l1 UTSW 19 5,768,785 (GRCm39) missense probably benign 0.01
R7106:Ehbp1l1 UTSW 19 5,768,765 (GRCm39) missense probably benign 0.33
R7262:Ehbp1l1 UTSW 19 5,768,474 (GRCm39) nonsense probably null
R7304:Ehbp1l1 UTSW 19 5,766,410 (GRCm39) missense probably damaging 1.00
R7317:Ehbp1l1 UTSW 19 5,770,730 (GRCm39) missense probably benign 0.44
R7404:Ehbp1l1 UTSW 19 5,770,872 (GRCm39) missense possibly damaging 0.72
R7447:Ehbp1l1 UTSW 19 5,769,456 (GRCm39) missense possibly damaging 0.53
R7862:Ehbp1l1 UTSW 19 5,770,851 (GRCm39) missense probably benign
R7881:Ehbp1l1 UTSW 19 5,769,426 (GRCm39) missense probably benign
R7910:Ehbp1l1 UTSW 19 5,766,452 (GRCm39) missense probably benign 0.28
R8239:Ehbp1l1 UTSW 19 5,770,089 (GRCm39) missense possibly damaging 0.53
R8309:Ehbp1l1 UTSW 19 5,767,103 (GRCm39) missense probably damaging 1.00
R8324:Ehbp1l1 UTSW 19 5,770,026 (GRCm39) missense possibly damaging 0.86
R8724:Ehbp1l1 UTSW 19 5,765,886 (GRCm39) missense possibly damaging 0.73
R9260:Ehbp1l1 UTSW 19 5,769,278 (GRCm39) missense probably benign 0.07
R9453:Ehbp1l1 UTSW 19 5,758,371 (GRCm39) missense unknown
RF053:Ehbp1l1 UTSW 19 5,766,030 (GRCm39) small deletion probably benign
Z1088:Ehbp1l1 UTSW 19 5,766,315 (GRCm39) missense possibly damaging 0.77
Z1176:Ehbp1l1 UTSW 19 5,767,917 (GRCm39) missense probably benign
Z1177:Ehbp1l1 UTSW 19 5,769,462 (GRCm39) missense probably benign 0.02
Z1177:Ehbp1l1 UTSW 19 5,769,130 (GRCm39) missense probably benign 0.01
Z1177:Ehbp1l1 UTSW 19 5,769,129 (GRCm39) missense probably benign 0.07
Z1177:Ehbp1l1 UTSW 19 5,768,790 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCTCAATGTCTGGTTCTGGCCTG -3'
(R):5'- TCACAATGCAGTCCTCAGTGTCCC -3'

Sequencing Primer
(F):5'- AGAAGAGCCCATTCCTGTTG -3'
(R):5'- CCTCAGTGTCCCCTCCC -3'
Posted On 2013-04-16