Incidental Mutation 'R2846:Bahd1'
ID251571
Institutional Source Beutler Lab
Gene Symbol Bahd1
Ensembl Gene ENSMUSG00000040007
Gene Namebromo adjacent homology domain containing 1
SynonymsLOC228536
MMRRC Submission 040439-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2846 (G1)
Quality Score145
Status Not validated
Chromosome2
Chromosomal Location118900377-118924528 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118922523 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 757 (R757H)
Ref Sequence ENSEMBL: ENSMUSP00000043130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036578] [ENSMUST00000099546] [ENSMUST00000110837]
Predicted Effect probably damaging
Transcript: ENSMUST00000036578
AA Change: R757H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043130
Gene: ENSMUSG00000040007
AA Change: R757H

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 117 141 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
low complexity region 564 579 N/A INTRINSIC
BAH 616 771 1.17e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099546
SMART Domains Protein: ENSMUSP00000099579
Gene: ENSMUSG00000074916

DomainStartEndE-ValueType
low complexity region 18 42 N/A INTRINSIC
Pfam:Sulfotransfer_2 139 365 1.6e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110837
SMART Domains Protein: ENSMUSP00000106461
Gene: ENSMUSG00000074916

DomainStartEndE-ValueType
low complexity region 18 42 N/A INTRINSIC
Pfam:Sulfotransfer_2 135 340 1.5e-41 PFAM
Meta Mutation Damage Score 0.8159 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg4a G A X: 140,992,840 E106K probably benign Het
Cdnf T A 2: 3,513,128 M1K probably null Het
Ddx4 T A 13: 112,604,612 K496M probably damaging Het
Dlg1 T C 16: 31,863,197 S779P probably damaging Het
Dtna T A 18: 23,651,503 probably null Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Gal3st2c A T 1: 93,996,400 Q8L possibly damaging Het
Hsd3b1 T C 3: 98,852,778 E299G probably damaging Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Irs4 C A X: 141,724,340 G287W probably damaging Het
Kif21a T C 15: 90,934,464 I1570V probably benign Het
Kremen1 GG GGGCG 11: 5,201,793 probably benign Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mindy4 T C 6: 55,278,100 V521A probably damaging Het
Olfr119 T C 17: 37,700,823 I51T probably damaging Het
Olfr384 A T 11: 73,603,383 T268S probably benign Het
Pdgfrb C T 18: 61,064,016 P175S probably benign Het
Pign C A 1: 105,657,796 L9F possibly damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Ppfia3 C A 7: 45,356,428 R348L probably damaging Het
Prr12 G C 7: 45,046,012 S1343R unknown Het
Psmd13 C A 7: 140,897,740 probably benign Het
Qpct A G 17: 79,070,742 T114A probably damaging Het
Sec24d A G 3: 123,350,746 D624G probably damaging Het
Shank2 A G 7: 144,070,055 Y259C probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Smarcb1 C A 10: 75,897,541 R332L probably damaging Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
St18 T A 1: 6,845,587 C819S probably damaging Het
Tas2r124 A G 6: 132,755,267 N180D possibly damaging Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Tmem204 G A 17: 25,080,333 H71Y probably benign Het
Vmn1r212 A G 13: 22,884,092 S24P probably damaging Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zmiz1 A G 14: 25,645,675 S259G probably benign Het
Other mutations in Bahd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02113:Bahd1 APN 2 118917205 missense probably benign 0.01
IGL02425:Bahd1 APN 2 118919164 missense probably benign 0.00
IGL02548:Bahd1 APN 2 118917045 missense possibly damaging 0.79
IGL03024:Bahd1 APN 2 118916116 missense probably damaging 1.00
R0932:Bahd1 UTSW 2 118915927 missense probably damaging 1.00
R1737:Bahd1 UTSW 2 118915923 missense probably damaging 1.00
R2845:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R2899:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R2900:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R2966:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R2985:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R2986:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R3017:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3018:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3019:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3020:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3021:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3033:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3040:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3431:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R3432:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R3617:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R4319:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R4394:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R4395:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R4418:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R4456:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R4462:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R4484:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R5537:Bahd1 UTSW 2 118915980 missense probably damaging 0.96
R5556:Bahd1 UTSW 2 118916270 missense probably damaging 1.00
R6490:Bahd1 UTSW 2 118917138 missense probably benign 0.01
R6736:Bahd1 UTSW 2 118915975 missense possibly damaging 0.54
R7604:Bahd1 UTSW 2 118916310 missense probably benign
Z1176:Bahd1 UTSW 2 118922403 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCAGTGCCAGCTCAGTG -3'
(R):5'- AGCTGAGGGTCTAGATACCTTTC -3'

Sequencing Primer
(F):5'- CAGTGCCAGCTCAGTGTTAGG -3'
(R):5'- GAGGGTCTAGATACCTTTCTCATATC -3'
Posted On2014-12-04