Incidental Mutation 'R2846:Slc15a4'
ID251585
Institutional Source Beutler Lab
Gene Symbol Slc15a4
Ensembl Gene ENSMUSG00000029416
Gene Namesolute carrier family 15, member 4
SynonymsPHT1, C130069N12Rik, PTR4
MMRRC Submission 040439-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R2846 (G1)
Quality Score201
Status Not validated
Chromosome5
Chromosomal Location127595664-127632897 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 127604536 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000031367] [ENSMUST00000152727] [ENSMUST00000152727] [ENSMUST00000153832] [ENSMUST00000155321]
Predicted Effect probably null
Transcript: ENSMUST00000031367
SMART Domains Protein: ENSMUSP00000031367
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
Pfam:MFS_1 33 505 7.8e-13 PFAM
Pfam:PTR2 96 519 3.6e-127 PFAM
transmembrane domain 533 555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124569
SMART Domains Protein: ENSMUSP00000121595
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:PTR2 49 242 8.1e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144603
SMART Domains Protein: ENSMUSP00000116420
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
Pfam:PTR2 7 127 2.2e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000152727
SMART Domains Protein: ENSMUSP00000116529
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
Pfam:PTR2 1 81 3.9e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000152727
SMART Domains Protein: ENSMUSP00000116529
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
Pfam:PTR2 1 81 3.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153832
SMART Domains Protein: ENSMUSP00000123116
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
transmembrane domain 67 89 N/A INTRINSIC
Pfam:PTR2 96 292 5e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155321
SMART Domains Protein: ENSMUSP00000117258
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
Pfam:PTR2 7 105 1e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000198486
Predicted Effect probably null
Transcript: ENSMUST00000198486
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199810
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200212
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation display abrogation of both Toll-like receptor (TLR)-induced type I IFN and proinflammatory cytokine production by plasmacytoid dendritic cells. Conventional dendritic cells respond normally to TLR ligands. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg4a G A X: 140,992,840 E106K probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Cdnf T A 2: 3,513,128 M1K probably null Het
Ddx4 T A 13: 112,604,612 K496M probably damaging Het
Dlg1 T C 16: 31,863,197 S779P probably damaging Het
Dtna T A 18: 23,651,503 probably null Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Gal3st2c A T 1: 93,996,400 Q8L possibly damaging Het
Hsd3b1 T C 3: 98,852,778 E299G probably damaging Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Irs4 C A X: 141,724,340 G287W probably damaging Het
Kif21a T C 15: 90,934,464 I1570V probably benign Het
Kremen1 GG GGGCG 11: 5,201,793 probably benign Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mindy4 T C 6: 55,278,100 V521A probably damaging Het
Olfr119 T C 17: 37,700,823 I51T probably damaging Het
Olfr384 A T 11: 73,603,383 T268S probably benign Het
Pdgfrb C T 18: 61,064,016 P175S probably benign Het
Pign C A 1: 105,657,796 L9F possibly damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Ppfia3 C A 7: 45,356,428 R348L probably damaging Het
Prr12 G C 7: 45,046,012 S1343R unknown Het
Psmd13 C A 7: 140,897,740 probably benign Het
Qpct A G 17: 79,070,742 T114A probably damaging Het
Sec24d A G 3: 123,350,746 D624G probably damaging Het
Shank2 A G 7: 144,070,055 Y259C probably damaging Het
Smarcb1 C A 10: 75,897,541 R332L probably damaging Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
St18 T A 1: 6,845,587 C819S probably damaging Het
Tas2r124 A G 6: 132,755,267 N180D possibly damaging Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Tmem204 G A 17: 25,080,333 H71Y probably benign Het
Vmn1r212 A G 13: 22,884,092 S24P probably damaging Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zmiz1 A G 14: 25,645,675 S259G probably benign Het
Other mutations in Slc15a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Slc15a4 APN 5 127601960 missense probably benign 0.13
IGL01543:Slc15a4 APN 5 127603766 missense probably benign 0.12
IGL01805:Slc15a4 APN 5 127608836 missense possibly damaging 0.91
IGL02958:Slc15a4 APN 5 127604665 missense possibly damaging 0.93
IGL03367:Slc15a4 APN 5 127601941 missense probably damaging 1.00
feeble UTSW 5 127608770 unclassified probably benign
R0018:Slc15a4 UTSW 5 127602010 missense probably damaging 1.00
R0018:Slc15a4 UTSW 5 127602010 missense probably damaging 1.00
R0838:Slc15a4 UTSW 5 127617003 missense possibly damaging 0.53
R1544:Slc15a4 UTSW 5 127603768 missense probably benign 0.01
R1662:Slc15a4 UTSW 5 127608979 missense probably damaging 1.00
R2504:Slc15a4 UTSW 5 127617239 missense possibly damaging 0.92
R2843:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R2845:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R2900:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R2971:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R3018:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R3020:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R3021:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R3027:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R3053:Slc15a4 UTSW 5 127596682 missense possibly damaging 0.83
R3155:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R3432:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4356:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4357:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4359:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4448:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4449:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4450:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4514:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4544:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4546:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4952:Slc15a4 UTSW 5 127603837 missense probably damaging 1.00
R5278:Slc15a4 UTSW 5 127616969 missense probably damaging 0.99
R6393:Slc15a4 UTSW 5 127616886 missense probably benign 0.13
R6527:Slc15a4 UTSW 5 127596709 missense probably damaging 1.00
R7409:Slc15a4 UTSW 5 127604678 missense probably benign 0.04
Z1177:Slc15a4 UTSW 5 127600524 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTCCAGGCACCCAAATG -3'
(R):5'- AGCATTGTCACTAGGGGTGG -3'

Sequencing Primer
(F):5'- TTCCAGGCACCCAAATGACAAAG -3'
(R):5'- TGTTTCCCAAAGTGAAGGCC -3'
Posted On2014-12-04