Incidental Mutation 'R2846:Mindy4'
ID251589
Institutional Source Beutler Lab
Gene Symbol Mindy4
Ensembl Gene ENSMUSG00000038022
Gene NameMINDY lysine 48 deubiquitinase 4
SynonymsC330043M08Rik, LOC384387, Fam188b
MMRRC Submission 040439-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R2846 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location55203383-55320222 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55278100 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 521 (V521A)
Ref Sequence ENSEMBL: ENSMUSP00000145151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053094] [ENSMUST00000204842]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053094
AA Change: V521A

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000061221
Gene: ENSMUSG00000038022
AA Change: V521A

DomainStartEndE-ValueType
low complexity region 154 166 N/A INTRINSIC
low complexity region 224 240 N/A INTRINSIC
low complexity region 265 277 N/A INTRINSIC
DUF4205 403 739 1.47e-187 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203225
Predicted Effect probably damaging
Transcript: ENSMUST00000204842
AA Change: V521A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000145151
Gene: ENSMUSG00000038022
AA Change: V521A

DomainStartEndE-ValueType
low complexity region 154 166 N/A INTRINSIC
low complexity region 224 240 N/A INTRINSIC
low complexity region 265 277 N/A INTRINSIC
DUF4205 403 591 6.19e-10 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg4a G A X: 140,992,840 E106K probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Cdnf T A 2: 3,513,128 M1K probably null Het
Ddx4 T A 13: 112,604,612 K496M probably damaging Het
Dlg1 T C 16: 31,863,197 S779P probably damaging Het
Dtna T A 18: 23,651,503 probably null Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Gal3st2c A T 1: 93,996,400 Q8L possibly damaging Het
Hsd3b1 T C 3: 98,852,778 E299G probably damaging Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Irs4 C A X: 141,724,340 G287W probably damaging Het
Kif21a T C 15: 90,934,464 I1570V probably benign Het
Kremen1 GG GGGCG 11: 5,201,793 probably benign Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Olfr119 T C 17: 37,700,823 I51T probably damaging Het
Olfr384 A T 11: 73,603,383 T268S probably benign Het
Pdgfrb C T 18: 61,064,016 P175S probably benign Het
Pign C A 1: 105,657,796 L9F possibly damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Ppfia3 C A 7: 45,356,428 R348L probably damaging Het
Prr12 G C 7: 45,046,012 S1343R unknown Het
Psmd13 C A 7: 140,897,740 probably benign Het
Qpct A G 17: 79,070,742 T114A probably damaging Het
Sec24d A G 3: 123,350,746 D624G probably damaging Het
Shank2 A G 7: 144,070,055 Y259C probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Smarcb1 C A 10: 75,897,541 R332L probably damaging Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
St18 T A 1: 6,845,587 C819S probably damaging Het
Tas2r124 A G 6: 132,755,267 N180D possibly damaging Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Tmem204 G A 17: 25,080,333 H71Y probably benign Het
Vmn1r212 A G 13: 22,884,092 S24P probably damaging Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zmiz1 A G 14: 25,645,675 S259G probably benign Het
Other mutations in Mindy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Mindy4 APN 6 55284742 splice site probably benign
IGL01483:Mindy4 APN 6 55216685 missense probably damaging 1.00
IGL01721:Mindy4 APN 6 55223999 missense probably damaging 1.00
IGL01965:Mindy4 APN 6 55260532 splice site probably benign
IGL02214:Mindy4 APN 6 55216651 missense possibly damaging 0.88
IGL03058:Mindy4 APN 6 55308198 missense probably damaging 1.00
IGL03077:Mindy4 APN 6 55309330 missense probably damaging 1.00
IGL03296:Mindy4 APN 6 55297753 critical splice donor site probably null
R0383:Mindy4 UTSW 6 55276634 missense probably benign 0.00
R0384:Mindy4 UTSW 6 55216684 missense probably damaging 1.00
R0636:Mindy4 UTSW 6 55276585 missense possibly damaging 0.73
R0848:Mindy4 UTSW 6 55318286 nonsense probably null
R1171:Mindy4 UTSW 6 55255616 missense possibly damaging 0.75
R1210:Mindy4 UTSW 6 55284813 missense possibly damaging 0.92
R1341:Mindy4 UTSW 6 55255616 missense probably benign 0.00
R2030:Mindy4 UTSW 6 55211262 missense probably damaging 1.00
R2127:Mindy4 UTSW 6 55218265 missense probably benign 0.05
R2237:Mindy4 UTSW 6 55301070 missense probably damaging 1.00
R2238:Mindy4 UTSW 6 55301070 missense probably damaging 1.00
R2250:Mindy4 UTSW 6 55300949 missense probably damaging 0.99
R2571:Mindy4 UTSW 6 55284785 missense probably damaging 1.00
R3001:Mindy4 UTSW 6 55218364 missense probably benign 0.21
R3002:Mindy4 UTSW 6 55218364 missense probably benign 0.21
R3498:Mindy4 UTSW 6 55216525 missense probably benign 0.01
R4167:Mindy4 UTSW 6 55224346 missense possibly damaging 0.93
R4767:Mindy4 UTSW 6 55260565 missense probably damaging 0.98
R4812:Mindy4 UTSW 6 55279103 missense possibly damaging 0.64
R5109:Mindy4 UTSW 6 55216745 splice site probably null
R5203:Mindy4 UTSW 6 55255661 missense probably benign 0.00
R5221:Mindy4 UTSW 6 55224107 missense probably benign
R5628:Mindy4 UTSW 6 55260594 missense probably damaging 0.98
R6265:Mindy4 UTSW 6 55301064 missense probably damaging 0.99
R6596:Mindy4 UTSW 6 55224016 missense probably damaging 0.99
R7084:Mindy4 UTSW 6 55278235 missense probably benign
R7350:Mindy4 UTSW 6 55301025 missense probably damaging 0.97
R7535:Mindy4 UTSW 6 55297753 critical splice donor site probably null
R7625:Mindy4 UTSW 6 55276613 missense possibly damaging 0.95
R8052:Mindy4 UTSW 6 55300992 missense probably damaging 0.99
X0065:Mindy4 UTSW 6 55262816 missense probably damaging 0.99
Z1177:Mindy4 UTSW 6 55224341 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGGTTGTTCCAAGCTCACCC -3'
(R):5'- TCTGATGAGCCAAACCACGC -3'

Sequencing Primer
(F):5'- CATGCCCTGGACTTGTGG -3'
(R):5'- TGAGCCAAACCACGCCAAAC -3'
Posted On2014-12-04