Incidental Mutation 'R2846:Tas2r124'
ID251591
Institutional Source Beutler Lab
Gene Symbol Tas2r124
Ensembl Gene ENSMUSG00000060412
Gene Nametaste receptor, type 2, member 124
SynonymsT2R24, mGR24, mt2r50, Tas2r24
MMRRC Submission 040439-MU
Accession Numbers

NCBI RefSeq: NM_207026.1; MGI:2681267

Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R2846 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location132754730-132755659 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 132755267 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 180 (N180D)
Ref Sequence ENSEMBL: ENSMUSP00000075509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076150]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076150
AA Change: N180D

PolyPhen 2 Score 0.726 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000075509
Gene: ENSMUSG00000060412
AA Change: N180D

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 2.3e-92 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg4a G A X: 140,992,840 E106K probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Cdnf T A 2: 3,513,128 M1K probably null Het
Ddx4 T A 13: 112,604,612 K496M probably damaging Het
Dlg1 T C 16: 31,863,197 S779P probably damaging Het
Dtna T A 18: 23,651,503 probably null Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Gal3st2c A T 1: 93,996,400 Q8L possibly damaging Het
Hsd3b1 T C 3: 98,852,778 E299G probably damaging Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Irs4 C A X: 141,724,340 G287W probably damaging Het
Kif21a T C 15: 90,934,464 I1570V probably benign Het
Kremen1 GG GGGCG 11: 5,201,793 probably benign Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mindy4 T C 6: 55,278,100 V521A probably damaging Het
Olfr119 T C 17: 37,700,823 I51T probably damaging Het
Olfr384 A T 11: 73,603,383 T268S probably benign Het
Pdgfrb C T 18: 61,064,016 P175S probably benign Het
Pign C A 1: 105,657,796 L9F possibly damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Ppfia3 C A 7: 45,356,428 R348L probably damaging Het
Prr12 G C 7: 45,046,012 S1343R unknown Het
Psmd13 C A 7: 140,897,740 probably benign Het
Qpct A G 17: 79,070,742 T114A probably damaging Het
Sec24d A G 3: 123,350,746 D624G probably damaging Het
Shank2 A G 7: 144,070,055 Y259C probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Smarcb1 C A 10: 75,897,541 R332L probably damaging Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
St18 T A 1: 6,845,587 C819S probably damaging Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Tmem204 G A 17: 25,080,333 H71Y probably benign Het
Vmn1r212 A G 13: 22,884,092 S24P probably damaging Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zmiz1 A G 14: 25,645,675 S259G probably benign Het
Other mutations in Tas2r124
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Tas2r124 APN 6 132755529 missense probably benign 0.02
IGL01343:Tas2r124 APN 6 132755415 missense probably damaging 1.00
IGL01646:Tas2r124 APN 6 132755369 missense probably damaging 0.98
IGL01743:Tas2r124 APN 6 132754835 missense probably benign 0.01
IGL02251:Tas2r124 APN 6 132755561 missense probably benign 0.02
IGL03081:Tas2r124 APN 6 132755534 missense possibly damaging 0.61
IGL03309:Tas2r124 APN 6 132754935 missense probably benign 0.01
IGL03374:Tas2r124 APN 6 132755118 missense probably benign 0.00
P0012:Tas2r124 UTSW 6 132755540 missense possibly damaging 0.70
R1450:Tas2r124 UTSW 6 132755056 missense probably damaging 1.00
R1804:Tas2r124 UTSW 6 132755525 missense probably benign 0.11
R2048:Tas2r124 UTSW 6 132754895 missense possibly damaging 0.94
R3415:Tas2r124 UTSW 6 132755638 missense probably benign 0.00
R3416:Tas2r124 UTSW 6 132755638 missense probably benign 0.00
R3417:Tas2r124 UTSW 6 132755638 missense probably benign 0.00
R4306:Tas2r124 UTSW 6 132754991 missense probably benign 0.03
R4308:Tas2r124 UTSW 6 132754991 missense probably benign 0.03
R4823:Tas2r124 UTSW 6 132755546 missense probably damaging 0.98
R4867:Tas2r124 UTSW 6 132755193 missense probably damaging 0.98
R4949:Tas2r124 UTSW 6 132754895 missense possibly damaging 0.94
R5242:Tas2r124 UTSW 6 132755540 missense possibly damaging 0.70
R6001:Tas2r124 UTSW 6 132755453 missense probably damaging 0.99
R6263:Tas2r124 UTSW 6 132754904 missense probably benign 0.45
R6313:Tas2r124 UTSW 6 132755447 missense probably benign 0.00
R6394:Tas2r124 UTSW 6 132755076 missense probably damaging 1.00
R7685:Tas2r124 UTSW 6 132755093 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGAGAATAAAGCAACTGATTGTCC -3'
(R):5'- TGATTCTTCTGAGCAACCCATG -3'

Sequencing Primer
(F):5'- TCCACATGCTTCTGGGAAG -3'
(R):5'- CTTCTGAGCAACCCATGATATAAG -3'
Posted On2014-12-04