Incidental Mutation 'R2846:Prr12'
ID251593
Institutional Source Beutler Lab
Gene Symbol Prr12
Ensembl Gene ENSMUSG00000046574
Gene Nameproline rich 12
Synonyms
MMRRC Submission 040439-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock #R2846 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45027563-45052881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 45046012 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 1343 (S1343R)
Ref Sequence ENSEMBL: ENSMUSP00000054702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057293]
Predicted Effect unknown
Transcript: ENSMUST00000057293
AA Change: S1343R
SMART Domains Protein: ENSMUSP00000054702
Gene: ENSMUSG00000046574
AA Change: S1343R

DomainStartEndE-ValueType
low complexity region 135 150 N/A INTRINSIC
low complexity region 208 222 N/A INTRINSIC
low complexity region 225 242 N/A INTRINSIC
low complexity region 249 261 N/A INTRINSIC
low complexity region 330 376 N/A INTRINSIC
low complexity region 388 413 N/A INTRINSIC
low complexity region 418 444 N/A INTRINSIC
low complexity region 450 464 N/A INTRINSIC
low complexity region 469 487 N/A INTRINSIC
low complexity region 535 559 N/A INTRINSIC
low complexity region 598 616 N/A INTRINSIC
low complexity region 665 682 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 785 814 N/A INTRINSIC
low complexity region 830 841 N/A INTRINSIC
low complexity region 858 871 N/A INTRINSIC
low complexity region 883 896 N/A INTRINSIC
low complexity region 949 960 N/A INTRINSIC
low complexity region 964 986 N/A INTRINSIC
low complexity region 1033 1044 N/A INTRINSIC
low complexity region 1059 1070 N/A INTRINSIC
AT_hook 1161 1173 5.74e1 SMART
AT_hook 1193 1205 8.09e0 SMART
low complexity region 1252 1264 N/A INTRINSIC
low complexity region 1308 1328 N/A INTRINSIC
low complexity region 1417 1535 N/A INTRINSIC
low complexity region 1684 1748 N/A INTRINSIC
Pfam:DUF4211 1817 1950 6.5e-21 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a proline-rich protein that contains two A-T hook DNA binding domains. A chromosomal translocation and gene fusion between this gene and zinc finger, MIZ-type containing 1 (Gene ID: 57178) may underlie intellectual disability and neuropsychiatric problems in a human patient. Enriched expression of this gene in embryonic mouse brain suggests that this gene may play a role in nervous system development. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg4a G A X: 140,992,840 E106K probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Cdnf T A 2: 3,513,128 M1K probably null Het
Ddx4 T A 13: 112,604,612 K496M probably damaging Het
Dlg1 T C 16: 31,863,197 S779P probably damaging Het
Dtna T A 18: 23,651,503 probably null Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Gal3st2c A T 1: 93,996,400 Q8L possibly damaging Het
Hsd3b1 T C 3: 98,852,778 E299G probably damaging Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Irs4 C A X: 141,724,340 G287W probably damaging Het
Kif21a T C 15: 90,934,464 I1570V probably benign Het
Kremen1 GG GGGCG 11: 5,201,793 probably benign Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mindy4 T C 6: 55,278,100 V521A probably damaging Het
Olfr119 T C 17: 37,700,823 I51T probably damaging Het
Olfr384 A T 11: 73,603,383 T268S probably benign Het
Pdgfrb C T 18: 61,064,016 P175S probably benign Het
Pign C A 1: 105,657,796 L9F possibly damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Ppfia3 C A 7: 45,356,428 R348L probably damaging Het
Psmd13 C A 7: 140,897,740 probably benign Het
Qpct A G 17: 79,070,742 T114A probably damaging Het
Sec24d A G 3: 123,350,746 D624G probably damaging Het
Shank2 A G 7: 144,070,055 Y259C probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Smarcb1 C A 10: 75,897,541 R332L probably damaging Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
St18 T A 1: 6,845,587 C819S probably damaging Het
Tas2r124 A G 6: 132,755,267 N180D possibly damaging Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Tmem204 G A 17: 25,080,333 H71Y probably benign Het
Vmn1r212 A G 13: 22,884,092 S24P probably damaging Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zmiz1 A G 14: 25,645,675 S259G probably benign Het
Other mutations in Prr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01144:Prr12 APN 7 45047458 missense unknown
IGL01603:Prr12 APN 7 45043485 missense probably damaging 0.96
IGL01941:Prr12 APN 7 45048659 unclassified probably benign
IGL02043:Prr12 APN 7 45050005 unclassified probably benign
IGL02170:Prr12 APN 7 45046188 missense unknown
IGL02494:Prr12 APN 7 45028846 missense unknown
IGL02947:Prr12 APN 7 45048556 missense unknown
R0128:Prr12 UTSW 7 45050039 unclassified probably benign
R0255:Prr12 UTSW 7 45049991 unclassified probably benign
R0556:Prr12 UTSW 7 45030669 missense unknown
R1168:Prr12 UTSW 7 45029047 missense unknown
R1266:Prr12 UTSW 7 45050253 unclassified probably benign
R1374:Prr12 UTSW 7 45046218 missense unknown
R1531:Prr12 UTSW 7 45028530 missense unknown
R1537:Prr12 UTSW 7 45028942 missense unknown
R1572:Prr12 UTSW 7 45028800 missense unknown
R1617:Prr12 UTSW 7 45049594 unclassified probably benign
R1647:Prr12 UTSW 7 45034192 missense probably benign 0.20
R1694:Prr12 UTSW 7 45028579 missense unknown
R1732:Prr12 UTSW 7 45048356 missense unknown
R1819:Prr12 UTSW 7 45048697 unclassified probably benign
R2114:Prr12 UTSW 7 45046082 missense unknown
R2210:Prr12 UTSW 7 45049351 unclassified probably benign
R2902:Prr12 UTSW 7 45047612 missense unknown
R2985:Prr12 UTSW 7 45046012 missense unknown
R4094:Prr12 UTSW 7 45047947 missense unknown
R4498:Prr12 UTSW 7 45045914 missense unknown
R4523:Prr12 UTSW 7 45048523 missense unknown
R4763:Prr12 UTSW 7 45047695 missense unknown
R4775:Prr12 UTSW 7 45051325 unclassified probably benign
R4995:Prr12 UTSW 7 45051229 unclassified probably benign
R5007:Prr12 UTSW 7 45049801 unclassified probably benign
R5045:Prr12 UTSW 7 45049894 unclassified probably benign
R5184:Prr12 UTSW 7 45046377 missense unknown
R5897:Prr12 UTSW 7 45043384 missense probably damaging 1.00
R6847:Prr12 UTSW 7 45045740 missense unknown
R6912:Prr12 UTSW 7 45048845 unclassified probably benign
R7147:Prr12 UTSW 7 45033850 missense unknown
X0066:Prr12 UTSW 7 45047003 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGTCCAGTGTCTAAAGGCG -3'
(R):5'- CTTTCTCAAGTCAGGCAAGCG -3'

Sequencing Primer
(F):5'- AGTGTCTAAAGGCGGCTCCTC -3'
(R):5'- GCGGCACCCACCACTCTAC -3'
Posted On2014-12-04