Mutagenetix > Incidental Mutation

Incidental Mutation 'R2846:Shank2'

251599

Institutional Source

Beutler Lab

Gene Symbol

Shank2

Ensembl Gene

ENSMUSG00000037541

Gene Name

SH3 and multiple ankyrin repeat domains 2

Synonyms

ProSAP1

MMRRC Submission

040439-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2846 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

143555665-143978231 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 143623792 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 259 (Y259C)

Ref Sequence

ENSEMBL: ENSMUSP00000101522 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105902] [ENSMUST00000213146]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000105902
AA Change: Y259C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101522
Gene: ENSMUSG00000037541
AA Change: Y259C

Domain	Start	End	E-Value	Type
low complexity region	15	28	N/A	INTRINSIC
Pfam:FERM_f0	57	140	1.4e-21	PFAM
ANK	196	226	1.4e1	SMART
ANK	230	259	2.77e-3	SMART
ANK	263	293	1.42e0	SMART
ANK	297	326	1.25e-1	SMART
ANK	330	359	7.83e-3	SMART
ANK	363	391	1.29e2	SMART
SH3	529	584	1.04e-14	SMART
PDZ	635	720	1.75e-14	SMART
low complexity region	724	743	N/A	INTRINSIC
low complexity region	878	893	N/A	INTRINSIC
low complexity region	1031	1043	N/A	INTRINSIC
low complexity region	1118	1129	N/A	INTRINSIC
low complexity region	1149	1161	N/A	INTRINSIC
low complexity region	1198	1216	N/A	INTRINSIC
low complexity region	1393	1407	N/A	INTRINSIC
low complexity region	1462	1473	N/A	INTRINSIC
low complexity region	1494	1516	N/A	INTRINSIC
low complexity region	1530	1546	N/A	INTRINSIC
low complexity region	1568	1576	N/A	INTRINSIC
low complexity region	1656	1670	N/A	INTRINSIC
low complexity region	1713	1728	N/A	INTRINSIC
low complexity region	1752	1766	N/A	INTRINSIC
SAM	1775	1841	2.52e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000213146
AA Change: Y259C

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the Shank family of synaptic proteins that may function as molecular scaffolds in the postsynaptic density of excitatory synapses. Shank proteins contain multiple domains for protein-protein interaction, including ankyrin repeats, and an SH3 domain. This particular family member contains a PDZ domain, a consensus sequence for cortactin SH3 domain-binding peptides and a sterile alpha motif. The alternative splicing demonstrated in Shank genes has been suggested as a mechanism for regulating the molecular structure of Shank and the spectrum of Shank-interacting proteins in the postsynaptic densities of the adult and developing brain. Alterations in the encoded protein may be associated with susceptibility to autism spectrum disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for null mutations display hyperactivity and abnormal social behavior. Mice homozygous for one null allele also display partial postnal lethality and limb grasping. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atg4a	G	A	X: 139,893,589 (GRCm39)	E106K	probably benign	Het
Bahd1	G	A	2: 118,753,004 (GRCm39)	R757H	probably damaging	Het
Cdnf	T	A	2: 3,514,165 (GRCm39)	M1K	probably null	Het
Ddx4	T	A	13: 112,741,146 (GRCm39)	K496M	probably damaging	Het
Dlg1	T	C	16: 31,682,015 (GRCm39)	S779P	probably damaging	Het
Dtna	T	A	18: 23,784,560 (GRCm39)		probably null	Het
Fhad1	G	T	4: 141,632,279 (GRCm39)	Q1287K	probably benign	Het
Gal3st2c	A	T	1: 93,924,122 (GRCm39)	Q8L	possibly damaging	Het
Hsd3b1	T	C	3: 98,760,094 (GRCm39)	E299G	probably damaging	Het
Hydin	T	C	8: 111,245,746 (GRCm39)	V2153A	probably benign	Het
Irs4	C	A	X: 140,507,336 (GRCm39)	G287W	probably damaging	Het
Kif21a	T	C	15: 90,818,667 (GRCm39)	I1570V	probably benign	Het
Kremen1	GG	GGGCG	11: 5,151,793 (GRCm39)		probably benign	Het
Mark2	T	C	19: 7,264,227 (GRCm39)	E116G	probably damaging	Het
Mfsd13a	C	T	19: 46,360,431 (GRCm39)	R328C	probably damaging	Het
Mindy4	T	C	6: 55,255,085 (GRCm39)	V521A	probably damaging	Het
Or10al3	T	C	17: 38,011,714 (GRCm39)	I51T	probably damaging	Het
Or1e25	A	T	11: 73,494,209 (GRCm39)	T268S	probably benign	Het
Pdgfrb	C	T	18: 61,197,088 (GRCm39)	P175S	probably benign	Het
Pign	C	A	1: 105,585,521 (GRCm39)	L9F	possibly damaging	Het
Plekha1	G	T	7: 130,510,095 (GRCm39)	W280C	probably damaging	Het
Ppfia3	C	A	7: 45,005,852 (GRCm39)	R348L	probably damaging	Het
Prr12	G	C	7: 44,695,436 (GRCm39)	S1343R	unknown	Het
Psmd13	C	A	7: 140,477,653 (GRCm39)		probably benign	Het
Qpct	A	G	17: 79,378,171 (GRCm39)	T114A	probably damaging	Het
Sec24d	A	G	3: 123,144,395 (GRCm39)	D624G	probably damaging	Het
Slc15a4	A	G	5: 127,681,600 (GRCm39)		probably null	Het
Smarcb1	C	A	10: 75,733,375 (GRCm39)	R332L	probably damaging	Het
Ssh3	T	C	19: 4,315,324 (GRCm39)	Y338C	probably damaging	Het
St18	T	A	1: 6,915,811 (GRCm39)	C819S	probably damaging	Het
Tas2r124	A	G	6: 132,732,230 (GRCm39)	N180D	possibly damaging	Het
Tgfbr3l	A	G	8: 4,299,280 (GRCm39)	D49G	probably damaging	Het
Tmem204	G	A	17: 25,299,307 (GRCm39)	H71Y	probably benign	Het
Vmn1r212	A	G	13: 23,068,262 (GRCm39)	S24P	probably damaging	Het
Vmn2r6	A	G	3: 64,464,211 (GRCm39)	S208P	possibly damaging	Het
Zbtb8os	A	T	4: 129,235,309 (GRCm39)	E54D	probably damaging	Het
Zmiz1	A	G	14: 25,646,099 (GRCm39)	S259G	probably benign	Het

Other mutations in Shank2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Shank2	APN	7	143,965,584 (GRCm39)	missense	probably damaging	1.00
IGL00516:Shank2	APN	7	143,964,512 (GRCm39)	missense	possibly damaging	0.96
IGL00919:Shank2	APN	7	143,965,008 (GRCm39)	missense	probably damaging	0.97
IGL01450:Shank2	APN	7	143,838,805 (GRCm39)	nonsense	probably null
IGL01996:Shank2	APN	7	143,965,230 (GRCm39)	missense	probably damaging	1.00
IGL02217:Shank2	APN	7	143,838,784 (GRCm39)	missense	possibly damaging	0.59
IGL02314:Shank2	APN	7	143,965,008 (GRCm39)	missense	probably benign	0.01
IGL02320:Shank2	APN	7	143,974,681 (GRCm39)	missense	probably damaging	1.00
IGL02948:Shank2	APN	7	143,963,373 (GRCm39)	missense	probably benign	0.03
IGL02997:Shank2	APN	7	143,635,610 (GRCm39)	missense	probably benign	0.16
R0077:Shank2	UTSW	7	143,746,204 (GRCm39)	missense	possibly damaging	0.85
R0109:Shank2	UTSW	7	143,964,314 (GRCm39)	missense	possibly damaging	0.81
R0126:Shank2	UTSW	7	143,585,092 (GRCm39)	missense	probably damaging	0.99
R0153:Shank2	UTSW	7	143,623,872 (GRCm39)	missense	probably benign	0.04
R0644:Shank2	UTSW	7	143,965,586 (GRCm39)	missense	probably benign
R1072:Shank2	UTSW	7	143,965,305 (GRCm39)	missense	probably damaging	1.00
R1245:Shank2	UTSW	7	143,965,457 (GRCm39)	missense	probably benign	0.00
R1424:Shank2	UTSW	7	143,606,109 (GRCm39)	missense	probably damaging	0.99
R1712:Shank2	UTSW	7	143,964,890 (GRCm39)	missense	probably damaging	1.00
R1739:Shank2	UTSW	7	143,733,590 (GRCm39)	missense	probably damaging	1.00
R1791:Shank2	UTSW	7	143,964,336 (GRCm39)	missense	probably damaging	1.00
R1889:Shank2	UTSW	7	143,740,595 (GRCm39)	nonsense	probably null
R2074:Shank2	UTSW	7	143,963,277 (GRCm39)	missense	probably damaging	1.00
R2135:Shank2	UTSW	7	143,964,971 (GRCm39)	missense	probably damaging	0.99
R2355:Shank2	UTSW	7	143,611,455 (GRCm39)	missense	possibly damaging	0.94
R2511:Shank2	UTSW	7	143,965,314 (GRCm39)	missense	probably damaging	1.00
R2517:Shank2	UTSW	7	143,606,042 (GRCm39)	missense	possibly damaging	0.89
R2570:Shank2	UTSW	7	143,622,507 (GRCm39)	missense	probably damaging	1.00
R3159:Shank2	UTSW	7	143,635,611 (GRCm39)	missense	probably damaging	0.98
R3881:Shank2	UTSW	7	143,959,121 (GRCm39)	missense	probably benign
R3907:Shank2	UTSW	7	143,963,313 (GRCm39)	missense	probably damaging	1.00
R3938:Shank2	UTSW	7	143,682,112 (GRCm39)	missense	probably benign	0.20
R4151:Shank2	UTSW	7	143,608,565 (GRCm39)	missense	probably damaging	1.00
R4369:Shank2	UTSW	7	143,733,518 (GRCm39)	missense	probably damaging	0.99
R4372:Shank2	UTSW	7	143,964,599 (GRCm39)	missense	probably benign	0.09
R4519:Shank2	UTSW	7	143,963,942 (GRCm39)	missense	probably damaging	1.00
R4627:Shank2	UTSW	7	143,965,161 (GRCm39)	missense	probably damaging	1.00
R4645:Shank2	UTSW	7	143,964,159 (GRCm39)	missense	possibly damaging	0.65
R4647:Shank2	UTSW	7	143,965,566 (GRCm39)	missense	probably damaging	1.00
R4689:Shank2	UTSW	7	143,974,342 (GRCm39)	missense	probably benign	0.07
R4751:Shank2	UTSW	7	143,963,205 (GRCm39)	missense	probably damaging	1.00
R4816:Shank2	UTSW	7	143,606,043 (GRCm39)	missense	probably damaging	1.00
R4843:Shank2	UTSW	7	143,585,146 (GRCm39)	missense	probably benign	0.17
R4929:Shank2	UTSW	7	143,965,008 (GRCm39)	missense	probably benign	0.01
R5009:Shank2	UTSW	7	143,623,916 (GRCm39)	missense	probably benign	0.00
R5027:Shank2	UTSW	7	143,812,842 (GRCm39)	nonsense	probably null
R5165:Shank2	UTSW	7	143,963,373 (GRCm39)	missense	possibly damaging	0.62
R5278:Shank2	UTSW	7	143,622,612 (GRCm39)	critical splice donor site	probably null
R5332:Shank2	UTSW	7	143,965,029 (GRCm39)	missense	possibly damaging	0.82
R5497:Shank2	UTSW	7	143,963,271 (GRCm39)	missense	probably damaging	1.00
R5525:Shank2	UTSW	7	143,623,846 (GRCm39)	missense	probably damaging	1.00
R5575:Shank2	UTSW	7	143,963,871 (GRCm39)	missense	probably damaging	1.00
R5948:Shank2	UTSW	7	143,960,960 (GRCm39)	missense	probably damaging	0.98
R6024:Shank2	UTSW	7	143,733,768 (GRCm39)	missense	probably benign	0.12
R6306:Shank2	UTSW	7	143,963,417 (GRCm39)	missense	probably benign	0.00
R6317:Shank2	UTSW	7	143,838,821 (GRCm39)	missense	possibly damaging	0.89
R6358:Shank2	UTSW	7	143,585,034 (GRCm39)	missense	probably benign	0.25
R6364:Shank2	UTSW	7	143,964,146 (GRCm39)	missense	probably benign	0.14
R6413:Shank2	UTSW	7	143,963,955 (GRCm39)	missense	probably damaging	1.00
R6680:Shank2	UTSW	7	143,974,603 (GRCm39)	missense	probably damaging	1.00
R6834:Shank2	UTSW	7	143,963,631 (GRCm39)	missense	probably damaging	1.00
R6870:Shank2	UTSW	7	143,606,197 (GRCm39)	missense	probably damaging	0.99
R6933:Shank2	UTSW	7	143,645,515 (GRCm39)	missense	probably benign	0.19
R6983:Shank2	UTSW	7	143,635,585 (GRCm39)	missense	possibly damaging	0.94
R7082:Shank2	UTSW	7	143,964,096 (GRCm39)	missense	probably damaging	0.99
R7100:Shank2	UTSW	7	143,964,901 (GRCm39)	missense	possibly damaging	0.73
R7111:Shank2	UTSW	7	143,965,289 (GRCm39)	missense	probably benign	0.00
R7213:Shank2	UTSW	7	143,585,146 (GRCm39)	missense	probably benign	0.17
R7225:Shank2	UTSW	7	143,838,762 (GRCm39)	missense	probably benign	0.42
R7325:Shank2	UTSW	7	143,965,422 (GRCm39)	missense	probably benign	0.04
R7605:Shank2	UTSW	7	143,645,516 (GRCm39)	missense	possibly damaging	0.64
R7909:Shank2	UTSW	7	143,965,131 (GRCm39)	missense	probably damaging	1.00
R7976:Shank2	UTSW	7	143,964,798 (GRCm39)	missense	probably damaging	0.99
R8118:Shank2	UTSW	7	143,963,612 (GRCm39)	missense	probably benign	0.01
R8722:Shank2	UTSW	7	143,729,485 (GRCm39)	intron	probably benign
R8866:Shank2	UTSW	7	143,964,986 (GRCm39)	missense	probably benign
R8919:Shank2	UTSW	7	143,965,265 (GRCm39)	missense	probably damaging	1.00
R8944:Shank2	UTSW	7	143,623,927 (GRCm39)	missense	probably damaging	1.00
R9033:Shank2	UTSW	7	143,965,236 (GRCm39)	missense	probably damaging	0.99
R9091:Shank2	UTSW	7	143,963,705 (GRCm39)	missense	possibly damaging	0.76
R9252:Shank2	UTSW	7	143,622,535 (GRCm39)	missense	possibly damaging	0.96
R9270:Shank2	UTSW	7	143,963,705 (GRCm39)	missense	possibly damaging	0.76
R9350:Shank2	UTSW	7	143,960,945 (GRCm39)	missense	probably benign	0.00
R9362:Shank2	UTSW	7	143,963,271 (GRCm39)	missense	probably damaging	1.00
R9471:Shank2	UTSW	7	143,964,752 (GRCm39)	missense	possibly damaging	0.77
R9524:Shank2	UTSW	7	143,964,183 (GRCm39)	missense	possibly damaging	0.71
R9557:Shank2	UTSW	7	143,963,847 (GRCm39)	missense	probably benign	0.00
R9559:Shank2	UTSW	7	143,585,041 (GRCm39)	missense	probably benign	0.30
R9574:Shank2	UTSW	7	143,622,462 (GRCm39)	missense	possibly damaging	0.90
R9680:Shank2	UTSW	7	143,964,837 (GRCm39)	missense	probably damaging	0.96
R9720:Shank2	UTSW	7	143,682,137 (GRCm39)	missense	probably damaging	0.99
RF009:Shank2	UTSW	7	143,965,308 (GRCm39)	missense	possibly damaging	0.81
Z1176:Shank2	UTSW	7	143,682,114 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGCAGTTAGGACTCTCCAGTTTTG -3'
(R):5'- TAAACTTTTCAGGGCCCGGC -3'

Sequencing Primer
(F):5'- ACTCTCCAGTTTTGTGTGTGTCAG -3'
(R):5'- TCGCAGGGCTAGGATCTCAG -3'

Posted On

2014-12-04