Incidental Mutation 'R2508:Ralgapa1'
ID251600
Institutional Source Beutler Lab
Gene Symbol Ralgapa1
Ensembl Gene ENSMUSG00000021027
Gene NameRal GTPase activating protein, alpha subunit 1
SynonymsGarnl1, 4930400K19Rik, 2310003F20Rik, Tulip1
MMRRC Submission 040414-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.744) question?
Stock #R2508 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location55602896-55821167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55718201 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 889 (P889S)
Ref Sequence ENSEMBL: ENSMUSP00000151498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085385] [ENSMUST00000110687] [ENSMUST00000219432] [ENSMUST00000220367] [ENSMUST00000226244]
Predicted Effect probably damaging
Transcript: ENSMUST00000085385
AA Change: P889S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027
AA Change: P889S

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2003 7.4e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110687
AA Change: P889S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027
AA Change: P889S

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2001 1.9e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000219432
AA Change: P936S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219542
Predicted Effect probably damaging
Transcript: ENSMUST00000220367
AA Change: P889S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226244
AA Change: P1345S

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major subunit of the RAL-GTPase activating protein. A similar protein in mouse binds E12, a transcriptional regulator of immunoglobulin genes. The mouse protein also functions in skeletal muscle by binding to the regulatory 14-3-3 proteins upon stimulation with insulin or muscle contraction. A pseudogene of this gene has been identified on chromosome 9. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik C T 8: 120,145,393 T20I probably benign Het
Adamts2 C T 11: 50,788,689 T832I possibly damaging Het
Agbl1 G A 7: 76,589,550 probably null Het
Ankrd61 T C 5: 143,897,076 probably benign Het
Anpep T G 7: 79,838,291 Y506S possibly damaging Het
Aox2 T A 1: 58,343,673 H1037Q probably benign Het
Auh G A 13: 52,898,719 R47* probably null Het
B4galt5 T A 2: 167,306,638 M187L probably benign Het
Bub1 A T 2: 127,801,423 D1000E probably benign Het
Cacna1f T G X: 7,626,448 probably null Het
Cdh3 T C 8: 106,552,407 L667P probably damaging Het
Cenpe A T 3: 135,241,073 R1116S possibly damaging Het
Ces1b T A 8: 93,073,341 M136L possibly damaging Het
Cfap54 T C 10: 92,997,374 E1130G possibly damaging Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clu T C 14: 65,975,003 V135A probably damaging Het
Cmip T A 8: 117,436,693 S388T probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cox4i1 T A 8: 120,673,290 V51E possibly damaging Het
Crym T C 7: 120,201,827 N33S probably benign Het
Ctcf T A 8: 105,671,384 V434E probably damaging Het
D430042O09Rik T A 7: 125,795,343 V197D probably benign Het
Daam1 G A 12: 71,975,223 D732N probably damaging Het
Dcaf13 A G 15: 39,145,152 Y383C probably benign Het
Dock2 T C 11: 34,312,485 T957A probably benign Het
Duox1 A G 2: 122,333,138 D817G probably benign Het
Fads3 A G 19: 10,056,454 Y401C probably damaging Het
Fam72a T C 1: 131,528,854 probably null Het
Fbxw21 C A 9: 109,145,485 K322N probably benign Het
Fdxr G A 11: 115,271,980 T100I probably damaging Het
Galnt11 C G 5: 25,247,612 P41A probably damaging Het
Glb1l T C 1: 75,201,829 T322A probably damaging Het
Gm6803 T C 12: 88,018,488 Y95C probably damaging Het
Gm6871 T A 7: 41,547,990 T149S probably benign Het
Gpr26 C T 7: 131,967,094 T56I probably damaging Het
Grik4 C A 9: 42,622,142 G361C probably damaging Het
Gsr T G 8: 33,680,288 D200E probably benign Het
Igsf5 T A 16: 96,364,047 D7E probably benign Het
Inpp5e T A 2: 26,399,343 I522F probably damaging Het
Insm2 C A 12: 55,600,311 T280K probably benign Het
Itih4 T C 14: 30,895,478 V585A probably damaging Het
Knl1 A T 2: 119,058,368 R17* probably null Het
Lag3 G T 6: 124,911,309 L15I possibly damaging Het
Lepr T A 4: 101,790,896 S861T probably damaging Het
Mcur1 A T 13: 43,544,465 Y320N probably damaging Het
Mgam A T 6: 40,759,783 D872V probably damaging Het
Mlycd T C 8: 119,407,707 probably null Het
Mpl C A 4: 118,455,757 C193F probably damaging Het
Mycbp2 C A 14: 103,131,245 A4142S probably damaging Het
Myh1 T A 11: 67,213,598 D993E possibly damaging Het
N4bp2 T A 5: 65,790,061 D11E probably benign Het
Neb T C 2: 52,195,521 I1521V probably benign Het
Notch1 A G 2: 26,465,473 V1744A possibly damaging Het
Numa1 T C 7: 101,995,524 S236P possibly damaging Het
Olfr1056 A G 2: 86,356,364 L6P possibly damaging Het
Olfr1181 T C 2: 88,423,456 T190A possibly damaging Het
Olfr798 T A 10: 129,625,915 I49L probably benign Het
Otogl A G 10: 107,874,500 L576P probably damaging Het
P2ry1 C T 3: 61,003,479 T13M probably damaging Het
Pak6 A T 2: 118,694,569 R559* probably null Het
Papd4 A G 13: 93,184,218 L109S probably damaging Het
Parvb A T 15: 84,297,970 M234L probably benign Het
Pcdha11 T C 18: 37,012,854 V666A possibly damaging Het
Pde3b T A 7: 114,526,857 Y775* probably null Het
Pgam5 A G 5: 110,266,003 L98P probably damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Pkib T G 10: 57,728,109 D4E probably damaging Het
Plcb1 A T 2: 135,260,508 I202F probably benign Het
Pold3 A G 7: 100,121,383 V14A probably damaging Het
Prdm1 T A 10: 44,446,807 T249S probably benign Het
Prpf39 T A 12: 65,057,815 F551L probably benign Het
Prune2 A G 19: 17,122,622 E1830G probably benign Het
Rassf2 A T 2: 131,998,243 probably null Het
Rnf185 A G 11: 3,418,067 Y204H probably benign Het
Rpap1 A G 2: 119,780,054 probably null Het
Rufy3 T C 5: 88,649,898 S645P probably damaging Het
Scn11a T A 9: 119,765,529 Y1266F probably damaging Het
Senp7 T A 16: 56,151,362 H287Q probably benign Het
Sgsm3 T C 15: 81,003,872 probably null Het
Slc25a11 A T 11: 70,645,832 V104E possibly damaging Het
Slc25a13 G A 6: 6,117,190 T175I probably benign Het
Slc26a3 T A 12: 31,470,903 F702Y probably damaging Het
Smco2 T A 6: 146,859,967 L184H probably damaging Het
Ssc4d A T 5: 135,965,607 C90S probably damaging Het
Sspo T C 6: 48,464,364 S1835P probably damaging Het
Stk35 A G 2: 129,801,515 T140A probably damaging Het
Syngr1 C T 15: 80,111,740 T160M probably damaging Het
Tgfb1i1 A G 7: 128,248,913 probably null Het
Thoc1 T A 18: 9,977,947 V296E probably damaging Het
Timp2 C T 11: 118,310,586 C75Y probably damaging Het
Tlr1 T C 5: 64,925,296 Y646C probably damaging Het
Tprn G A 2: 25,268,928 E655K possibly damaging Het
Trbv14 A C 6: 41,135,490 I74L probably benign Het
Trbv5 T A 6: 41,062,621 Y53* probably null Het
Trpm5 T C 7: 143,088,919 Q97R possibly damaging Het
Tut1 A G 19: 8,955,567 D88G probably damaging Het
Ucp2 A T 7: 100,498,413 I200F probably benign Het
Unc45a G A 7: 80,338,875 S131L probably benign Het
Uty A T Y: 1,158,182 H573Q probably damaging Het
Vmn1r17 T A 6: 57,360,870 Y121F possibly damaging Het
Vmn1r53 T C 6: 90,223,572 I257V probably benign Het
Vmn2r90 C T 17: 17,733,967 L798F probably damaging Het
Vmn2r94 A T 17: 18,257,474 M225K probably benign Het
Wdr24 A T 17: 25,824,299 I32F possibly damaging Het
Zc3h11a T A 1: 133,624,783 T529S probably benign Het
Zc3h4 A G 7: 16,434,339 H791R unknown Het
Zfp24 A G 18: 24,017,870 L73P probably damaging Het
Zfp616 T C 11: 74,083,295 I130T probably benign Het
Zim1 ACAGCAG ACAGCAGCAG 7: 6,677,430 probably benign Het
Zim1 CAG CAGAAG 7: 6,677,431 probably benign Het
Other mutations in Ralgapa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ralgapa1 APN 12 55722773 missense probably damaging 0.98
IGL00494:Ralgapa1 APN 12 55747185 missense probably damaging 1.00
IGL00731:Ralgapa1 APN 12 55702452 missense possibly damaging 0.94
IGL00851:Ralgapa1 APN 12 55709575 missense possibly damaging 0.93
IGL01133:Ralgapa1 APN 12 55642348 missense probably damaging 1.00
IGL01133:Ralgapa1 APN 12 55642359 missense probably damaging 0.99
IGL01354:Ralgapa1 APN 12 55777316 missense possibly damaging 0.68
IGL01514:Ralgapa1 APN 12 55719657 missense probably damaging 0.97
IGL02033:Ralgapa1 APN 12 55642477 missense possibly damaging 0.69
IGL02064:Ralgapa1 APN 12 55708077 missense probably damaging 1.00
IGL02556:Ralgapa1 APN 12 55642449 missense possibly damaging 0.80
IGL02605:Ralgapa1 APN 12 55712665 missense possibly damaging 0.90
IGL02657:Ralgapa1 APN 12 55673507 missense probably damaging 1.00
IGL02676:Ralgapa1 APN 12 55676417 missense probably damaging 1.00
IGL02894:Ralgapa1 APN 12 55717069 missense possibly damaging 0.79
IGL02944:Ralgapa1 APN 12 55757951 missense probably benign 0.01
Anhydrous UTSW 12 55795778 critical splice acceptor site probably null
Aqueous UTSW 12 55698854 missense probably damaging 1.00
bantam UTSW 12 55722773 critical splice donor site probably null
Deliquescent UTSW 12 55782900 splice site probably benign
F5770:Ralgapa1 UTSW 12 55795653 splice site probably benign
IGL03046:Ralgapa1 UTSW 12 55695157 missense probably damaging 1.00
R0011:Ralgapa1 UTSW 12 55786263 missense probably damaging 0.99
R0096:Ralgapa1 UTSW 12 55739505 missense probably damaging 1.00
R0277:Ralgapa1 UTSW 12 55677238 missense probably damaging 0.99
R0323:Ralgapa1 UTSW 12 55677238 missense probably damaging 0.99
R0333:Ralgapa1 UTSW 12 55782900 splice site probably benign
R0361:Ralgapa1 UTSW 12 55676569 missense possibly damaging 0.93
R0385:Ralgapa1 UTSW 12 55677038 missense probably damaging 1.00
R0386:Ralgapa1 UTSW 12 55708067 missense probably benign 0.03
R0498:Ralgapa1 UTSW 12 55689791 missense possibly damaging 0.66
R0552:Ralgapa1 UTSW 12 55676765 missense probably benign 0.27
R0564:Ralgapa1 UTSW 12 55782885 missense possibly damaging 0.84
R0611:Ralgapa1 UTSW 12 55795698 missense probably damaging 0.99
R0730:Ralgapa1 UTSW 12 55665663 missense probably damaging 1.00
R0741:Ralgapa1 UTSW 12 55676581 missense probably damaging 0.99
R0815:Ralgapa1 UTSW 12 55762681 nonsense probably null
R0815:Ralgapa1 UTSW 12 55782777 splice site probably benign
R0863:Ralgapa1 UTSW 12 55782777 splice site probably benign
R0863:Ralgapa1 UTSW 12 55762681 nonsense probably null
R1068:Ralgapa1 UTSW 12 55790310 critical splice donor site probably null
R1147:Ralgapa1 UTSW 12 55702480 missense probably damaging 1.00
R1147:Ralgapa1 UTSW 12 55702480 missense probably damaging 1.00
R1256:Ralgapa1 UTSW 12 55762661 missense possibly damaging 0.94
R1343:Ralgapa1 UTSW 12 55707978 missense probably damaging 1.00
R1378:Ralgapa1 UTSW 12 55676926 missense probably damaging 1.00
R1474:Ralgapa1 UTSW 12 55741480 missense probably benign 0.09
R1494:Ralgapa1 UTSW 12 55684524 missense probably damaging 0.99
R1593:Ralgapa1 UTSW 12 55770703 missense probably damaging 1.00
R1607:Ralgapa1 UTSW 12 55741536 missense probably damaging 1.00
R1681:Ralgapa1 UTSW 12 55762603 missense probably benign 0.35
R1689:Ralgapa1 UTSW 12 55676767 missense possibly damaging 0.79
R1714:Ralgapa1 UTSW 12 55642389 missense probably damaging 1.00
R1832:Ralgapa1 UTSW 12 55757967 missense probably benign 0.03
R1870:Ralgapa1 UTSW 12 55677032 missense possibly damaging 0.66
R2040:Ralgapa1 UTSW 12 55786322 missense probably damaging 1.00
R2043:Ralgapa1 UTSW 12 55677026 missense probably damaging 0.99
R2046:Ralgapa1 UTSW 12 55695160 missense probably damaging 1.00
R2109:Ralgapa1 UTSW 12 55776188 missense possibly damaging 0.90
R2114:Ralgapa1 UTSW 12 55786349 critical splice acceptor site probably null
R2115:Ralgapa1 UTSW 12 55786349 critical splice acceptor site probably null
R2202:Ralgapa1 UTSW 12 55612800 intron probably null
R2203:Ralgapa1 UTSW 12 55612800 intron probably null
R2233:Ralgapa1 UTSW 12 55717071 missense probably benign 0.13
R2235:Ralgapa1 UTSW 12 55717071 missense probably benign 0.13
R2341:Ralgapa1 UTSW 12 55677124 missense possibly damaging 0.66
R2507:Ralgapa1 UTSW 12 55718201 missense probably damaging 1.00
R2972:Ralgapa1 UTSW 12 55820755 missense possibly damaging 0.61
R3160:Ralgapa1 UTSW 12 55709586 missense probably damaging 1.00
R3162:Ralgapa1 UTSW 12 55709586 missense probably damaging 1.00
R3401:Ralgapa1 UTSW 12 55659137 missense possibly damaging 0.66
R3416:Ralgapa1 UTSW 12 55770613 splice site probably benign
R3499:Ralgapa1 UTSW 12 55695143 splice site probably benign
R3799:Ralgapa1 UTSW 12 55659130 missense probably damaging 1.00
R3948:Ralgapa1 UTSW 12 55698767 missense probably damaging 1.00
R4039:Ralgapa1 UTSW 12 55795701 missense probably damaging 0.99
R4120:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4165:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4166:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4212:Ralgapa1 UTSW 12 55739330 critical splice donor site probably null
R4232:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4233:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4234:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4235:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4399:Ralgapa1 UTSW 12 55795778 critical splice acceptor site probably null
R4698:Ralgapa1 UTSW 12 55677276 splice site probably null
R4715:Ralgapa1 UTSW 12 55693458 missense probably damaging 1.00
R4755:Ralgapa1 UTSW 12 55712748 missense probably damaging 1.00
R4810:Ralgapa1 UTSW 12 55794993 critical splice donor site probably null
R4827:Ralgapa1 UTSW 12 55676437 missense probably damaging 1.00
R4849:Ralgapa1 UTSW 12 55698803 missense probably damaging 0.99
R4934:Ralgapa1 UTSW 12 55762574 missense possibly damaging 0.94
R5006:Ralgapa1 UTSW 12 55718114 missense probably benign 0.02
R5114:Ralgapa1 UTSW 12 55612723 missense possibly damaging 0.84
R5140:Ralgapa1 UTSW 12 55776152 missense probably damaging 1.00
R5140:Ralgapa1 UTSW 12 55665674 missense probably damaging 1.00
R5168:Ralgapa1 UTSW 12 55758032 missense probably benign 0.05
R5407:Ralgapa1 UTSW 12 55676797 missense possibly damaging 0.93
R5441:Ralgapa1 UTSW 12 55719623 missense probably damaging 1.00
R5473:Ralgapa1 UTSW 12 55676710 missense probably benign 0.41
R5624:Ralgapa1 UTSW 12 55612738 missense probably damaging 1.00
R5766:Ralgapa1 UTSW 12 55820766 start codon destroyed probably null 0.99
R5826:Ralgapa1 UTSW 12 55677113 missense probably damaging 1.00
R5950:Ralgapa1 UTSW 12 55738265 missense possibly damaging 0.58
R5980:Ralgapa1 UTSW 12 55770616 splice site probably null
R6019:Ralgapa1 UTSW 12 55684042 missense possibly damaging 0.92
R6065:Ralgapa1 UTSW 12 55757924 critical splice donor site probably null
R6326:Ralgapa1 UTSW 12 55747146 missense probably damaging 1.00
R6355:Ralgapa1 UTSW 12 55698854 missense probably damaging 1.00
R6408:Ralgapa1 UTSW 12 55683910 nonsense probably null
R6448:Ralgapa1 UTSW 12 55719661 missense probably benign 0.14
R6453:Ralgapa1 UTSW 12 55738319 missense probably damaging 1.00
R6590:Ralgapa1 UTSW 12 55722773 critical splice donor site probably null
R6690:Ralgapa1 UTSW 12 55722773 critical splice donor site probably null
R6738:Ralgapa1 UTSW 12 55762727 missense probably damaging 1.00
R6836:Ralgapa1 UTSW 12 55604273 splice site probably null
R6936:Ralgapa1 UTSW 12 55786212 missense probably damaging 0.99
R6945:Ralgapa1 UTSW 12 55776191 missense possibly damaging 0.64
R7028:Ralgapa1 UTSW 12 55758059 missense probably damaging 1.00
R7075:Ralgapa1 UTSW 12 55820723 missense possibly damaging 0.66
R7076:Ralgapa1 UTSW 12 55721576 missense possibly damaging 0.82
R7098:Ralgapa1 UTSW 12 55790310 critical splice donor site probably null
R7231:Ralgapa1 UTSW 12 55604191 missense probably damaging 1.00
R7254:Ralgapa1 UTSW 12 55695193 missense probably damaging 1.00
R7326:Ralgapa1 UTSW 12 55709004 missense probably damaging 1.00
R7485:Ralgapa1 UTSW 12 55712672 missense probably damaging 1.00
R7580:Ralgapa1 UTSW 12 55718228 missense probably benign 0.00
R7677:Ralgapa1 UTSW 12 55659143 missense probably damaging 0.96
R7702:Ralgapa1 UTSW 12 55709555 missense probably damaging 1.00
R7702:Ralgapa1 UTSW 12 55709556 missense probably damaging 1.00
R7707:Ralgapa1 UTSW 12 55777292 missense probably null 0.99
R7723:Ralgapa1 UTSW 12 55741513 missense probably benign
R7763:Ralgapa1 UTSW 12 55757955 missense probably benign 0.28
R7791:Ralgapa1 UTSW 12 55741519 missense probably damaging 0.97
R7812:Ralgapa1 UTSW 12 55719628 missense possibly damaging 0.67
R7868:Ralgapa1 UTSW 12 55612638 missense probably benign 0.00
R7895:Ralgapa1 UTSW 12 55747149 missense probably benign 0.44
R7896:Ralgapa1 UTSW 12 55697878 missense probably benign 0.01
R7951:Ralgapa1 UTSW 12 55612638 missense probably benign 0.00
R7978:Ralgapa1 UTSW 12 55747149 missense probably benign 0.44
R7979:Ralgapa1 UTSW 12 55697878 missense probably benign 0.01
R8004:Ralgapa1 UTSW 12 55702457 missense probably damaging 0.99
Z1176:Ralgapa1 UTSW 12 55709080 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACAAGTCAGGAAGCAGTC -3'
(R):5'- TCAGAGCCGTGTCATTACATG -3'

Sequencing Primer
(F):5'- AAGCAGTCAAGAGAAAACATATACTC -3'
(R):5'- CCAACTGTGGTCCTAACTATCAG -3'
Posted On2014-12-04