Incidental Mutation 'R2846:Tgfbr3l'
ID251601
Institutional Source Beutler Lab
Gene Symbol Tgfbr3l
Ensembl Gene ENSMUSG00000089736
Gene Nametransforming growth factor, beta receptor III-like
SynonymsLOC100039590, Gm14378
MMRRC Submission 040439-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2846 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location4248214-4251423 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4249280 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 49 (D49G)
Ref Sequence ENSEMBL: ENSMUSP00000106621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003027] [ENSMUST00000011981] [ENSMUST00000062686] [ENSMUST00000110993] [ENSMUST00000110994] [ENSMUST00000110995] [ENSMUST00000110996] [ENSMUST00000110998] [ENSMUST00000110999] [ENSMUST00000129866] [ENSMUST00000145165] [ENSMUST00000208316] [ENSMUST00000208459]
Predicted Effect probably benign
Transcript: ENSMUST00000003027
SMART Domains Protein: ENSMUSP00000003027
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
low complexity region 435 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000011981
SMART Domains Protein: ENSMUSP00000011981
Gene: ENSMUSG00000011837

DomainStartEndE-ValueType
Pfam:SnAPC_2_like 1 356 5.9e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000062686
SMART Domains Protein: ENSMUSP00000054512
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110993
AA Change: D49G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106621
Gene: ENSMUSG00000089736
AA Change: D49G

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
Pfam:Zona_pellucida 16 161 6.6e-15 PFAM
low complexity region 210 224 N/A INTRINSIC
low complexity region 227 263 N/A INTRINSIC
low complexity region 269 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110994
SMART Domains Protein: ENSMUSP00000106622
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
S_TKc 47 307 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110995
SMART Domains Protein: ENSMUSP00000106623
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
S_TKc 47 307 8.43e-72 SMART
low complexity region 346 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110996
SMART Domains Protein: ENSMUSP00000106624
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
S_TKc 92 352 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110998
SMART Domains Protein: ENSMUSP00000106626
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
low complexity region 53 73 N/A INTRINSIC
S_TKc 120 380 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110999
SMART Domains Protein: ENSMUSP00000106627
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
low complexity region 53 73 N/A INTRINSIC
S_TKc 120 380 8.43e-72 SMART
low complexity region 419 439 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129537
Predicted Effect probably benign
Transcript: ENSMUST00000129866
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142865
Predicted Effect silent
Transcript: ENSMUST00000145165
SMART Domains Protein: ENSMUSP00000117418
Gene: ENSMUSG00000109061

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208029
Predicted Effect probably benign
Transcript: ENSMUST00000208316
Predicted Effect probably benign
Transcript: ENSMUST00000208459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209051
Meta Mutation Damage Score 0.0907 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg4a G A X: 140,992,840 E106K probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Cdnf T A 2: 3,513,128 M1K probably null Het
Ddx4 T A 13: 112,604,612 K496M probably damaging Het
Dlg1 T C 16: 31,863,197 S779P probably damaging Het
Dtna T A 18: 23,651,503 probably null Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Gal3st2c A T 1: 93,996,400 Q8L possibly damaging Het
Hsd3b1 T C 3: 98,852,778 E299G probably damaging Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Irs4 C A X: 141,724,340 G287W probably damaging Het
Kif21a T C 15: 90,934,464 I1570V probably benign Het
Kremen1 GG GGGCG 11: 5,201,793 probably benign Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mindy4 T C 6: 55,278,100 V521A probably damaging Het
Olfr119 T C 17: 37,700,823 I51T probably damaging Het
Olfr384 A T 11: 73,603,383 T268S probably benign Het
Pdgfrb C T 18: 61,064,016 P175S probably benign Het
Pign C A 1: 105,657,796 L9F possibly damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Ppfia3 C A 7: 45,356,428 R348L probably damaging Het
Prr12 G C 7: 45,046,012 S1343R unknown Het
Psmd13 C A 7: 140,897,740 probably benign Het
Qpct A G 17: 79,070,742 T114A probably damaging Het
Sec24d A G 3: 123,350,746 D624G probably damaging Het
Shank2 A G 7: 144,070,055 Y259C probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Smarcb1 C A 10: 75,897,541 R332L probably damaging Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
St18 T A 1: 6,845,587 C819S probably damaging Het
Tas2r124 A G 6: 132,755,267 N180D possibly damaging Het
Tmem204 G A 17: 25,080,333 H71Y probably benign Het
Vmn1r212 A G 13: 22,884,092 S24P probably damaging Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zmiz1 A G 14: 25,645,675 S259G probably benign Het
Other mutations in Tgfbr3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0526:Tgfbr3l UTSW 8 4249439 missense possibly damaging 0.93
R1757:Tgfbr3l UTSW 8 4249548 missense probably benign 0.43
R1764:Tgfbr3l UTSW 8 4249282 missense probably benign 0.02
R1899:Tgfbr3l UTSW 8 4249600 missense probably damaging 1.00
R2266:Tgfbr3l UTSW 8 4250506 missense probably benign 0.01
R2267:Tgfbr3l UTSW 8 4250506 missense probably benign 0.01
R2268:Tgfbr3l UTSW 8 4250506 missense probably benign 0.01
R2844:Tgfbr3l UTSW 8 4249280 missense probably damaging 0.97
R2845:Tgfbr3l UTSW 8 4249280 missense probably damaging 0.97
R4695:Tgfbr3l UTSW 8 4250574 missense probably benign 0.33
R5059:Tgfbr3l UTSW 8 4249343 critical splice donor site probably null
R5708:Tgfbr3l UTSW 8 4250360 missense probably damaging 0.96
R5749:Tgfbr3l UTSW 8 4249310 missense probably damaging 0.97
R6898:Tgfbr3l UTSW 8 4250365 missense possibly damaging 0.70
R7078:Tgfbr3l UTSW 8 4249238 missense probably damaging 0.98
R7745:Tgfbr3l UTSW 8 4250622 missense possibly damaging 0.73
X0021:Tgfbr3l UTSW 8 4249642 missense probably damaging 0.97
Z1176:Tgfbr3l UTSW 8 4250508 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GAAAGAATTTGGCATGCGGC -3'
(R):5'- TGTTACTGAGCATCGGTGAAGG -3'

Sequencing Primer
(F):5'- AATTTGGCATGCGGCTGAGC -3'
(R):5'- TAGGCCCCATCTCGGTGAAG -3'
Posted On2014-12-04