Incidental Mutation 'R2846:Smarcb1'
ID251603
Institutional Source Beutler Lab
Gene Symbol Smarcb1
Ensembl Gene ENSMUSG00000000902
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1
SynonymsSnf5, SNF5/INI1, integrase interactor 1, Ini1, Baf47
MMRRC Submission 040439-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2846 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location75896769-75921617 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 75897541 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 332 (R332L)
Ref Sequence ENSEMBL: ENSMUSP00000112463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000925] [ENSMUST00000009236] [ENSMUST00000121304] [ENSMUST00000140388] [ENSMUST00000217811]
Predicted Effect probably damaging
Transcript: ENSMUST00000000925
AA Change: R341L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000925
Gene: ENSMUSG00000000902
AA Change: R341L

DomainStartEndE-ValueType
Blast:HX 31 52 9e-8 BLAST
Pfam:SNF5 179 254 1.1e-27 PFAM
Pfam:SNF5 249 373 3.1e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000009236
SMART Domains Protein: ENSMUSP00000009236
Gene: ENSMUSG00000009092

DomainStartEndE-ValueType
Pfam:DER1 13 203 7.4e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121304
AA Change: R332L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112463
Gene: ENSMUSG00000000902
AA Change: R332L

DomainStartEndE-ValueType
Blast:HX 31 52 9e-8 BLAST
Pfam:SNF5 169 364 1.7e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133189
Predicted Effect probably benign
Transcript: ENSMUST00000140388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140408
Predicted Effect probably benign
Transcript: ENSMUST00000217811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220190
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a complex that relieves repressive chromatin structures, allowing the transcriptional machinery to access its targets more effectively. The encoded nuclear protein may also bind to and enhance the DNA joining activity of HIV-1 integrase. This gene has been found to be a tumor suppressor, and mutations in it have been associated with malignant rhabdoid tumors. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to peri-implantation lethality, likely due to an inability of the blastocysts to hatch and implant in the uterus. A subset of heterozygous null mice develop a variety of tumors in the soft tissues of the head and neck. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg4a G A X: 140,992,840 E106K probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Cdnf T A 2: 3,513,128 M1K probably null Het
Ddx4 T A 13: 112,604,612 K496M probably damaging Het
Dlg1 T C 16: 31,863,197 S779P probably damaging Het
Dtna T A 18: 23,651,503 probably null Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Gal3st2c A T 1: 93,996,400 Q8L possibly damaging Het
Hsd3b1 T C 3: 98,852,778 E299G probably damaging Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Irs4 C A X: 141,724,340 G287W probably damaging Het
Kif21a T C 15: 90,934,464 I1570V probably benign Het
Kremen1 GG GGGCG 11: 5,201,793 probably benign Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mindy4 T C 6: 55,278,100 V521A probably damaging Het
Olfr119 T C 17: 37,700,823 I51T probably damaging Het
Olfr384 A T 11: 73,603,383 T268S probably benign Het
Pdgfrb C T 18: 61,064,016 P175S probably benign Het
Pign C A 1: 105,657,796 L9F possibly damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Ppfia3 C A 7: 45,356,428 R348L probably damaging Het
Prr12 G C 7: 45,046,012 S1343R unknown Het
Psmd13 C A 7: 140,897,740 probably benign Het
Qpct A G 17: 79,070,742 T114A probably damaging Het
Sec24d A G 3: 123,350,746 D624G probably damaging Het
Shank2 A G 7: 144,070,055 Y259C probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
St18 T A 1: 6,845,587 C819S probably damaging Het
Tas2r124 A G 6: 132,755,267 N180D possibly damaging Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Tmem204 G A 17: 25,080,333 H71Y probably benign Het
Vmn1r212 A G 13: 22,884,092 S24P probably damaging Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zmiz1 A G 14: 25,645,675 S259G probably benign Het
Other mutations in Smarcb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Smarcb1 APN 10 75916768 splice site probably null
IGL02399:Smarcb1 APN 10 75897494 missense probably damaging 1.00
IGL02457:Smarcb1 APN 10 75921371 missense probably benign 0.01
R0505:Smarcb1 UTSW 10 75897066 missense probably damaging 1.00
R1120:Smarcb1 UTSW 10 75921323 missense probably benign
R3725:Smarcb1 UTSW 10 75916786 missense probably benign 0.00
R5089:Smarcb1 UTSW 10 75915179 missense probably benign 0.00
R5157:Smarcb1 UTSW 10 75911794 intron probably benign
R5632:Smarcb1 UTSW 10 75904418 nonsense probably null
R5662:Smarcb1 UTSW 10 75904570 missense possibly damaging 0.95
R7472:Smarcb1 UTSW 10 75897539 missense probably damaging 1.00
Z1176:Smarcb1 UTSW 10 75906077 missense probably benign 0.00
Z1177:Smarcb1 UTSW 10 75904511 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACTGAAACTGCCTCTTGAAACTAG -3'
(R):5'- AGGCAGTGACAGAAGCCATC -3'

Sequencing Primer
(F):5'- CTAGGTTCCTGGGAAGAAGATACTCC -3'
(R):5'- ATCCGCACGGCTGCTAAGAG -3'
Posted On2014-12-04