Incidental Mutation 'R2846:Zmiz1'
ID251615
Institutional Source Beutler Lab
Gene Symbol Zmiz1
Ensembl Gene ENSMUSG00000007817
Gene Namezinc finger, MIZ-type containing 1
SynonymsRai17, Zimp10
MMRRC Submission 040439-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2846 (G1)
Quality Score215
Status Not validated
Chromosome14
Chromosomal Location25459185-25666743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25645675 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 259 (S259G)
Ref Sequence ENSEMBL: ENSMUSP00000124863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007961] [ENSMUST00000162645]
Predicted Effect probably benign
Transcript: ENSMUST00000007961
AA Change: S259G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000007961
Gene: ENSMUSG00000007817
AA Change: S259G

DomainStartEndE-ValueType
low complexity region 123 142 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 239 268 N/A INTRINSIC
SCOP:d1gkub1 280 323 1e-3 SMART
low complexity region 431 446 N/A INTRINSIC
low complexity region 483 495 N/A INTRINSIC
low complexity region 498 505 N/A INTRINSIC
low complexity region 511 526 N/A INTRINSIC
Pfam:zf-Nse 731 786 3.5e-8 PFAM
Pfam:zf-MIZ 739 788 7.6e-26 PFAM
low complexity region 867 881 N/A INTRINSIC
low complexity region 982 997 N/A INTRINSIC
low complexity region 1039 1062 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160229
SMART Domains Protein: ENSMUSP00000124820
Gene: ENSMUSG00000007817

DomainStartEndE-ValueType
low complexity region 59 77 N/A INTRINSIC
low complexity region 115 144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162645
AA Change: S259G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000124863
Gene: ENSMUSG00000007817
AA Change: S259G

DomainStartEndE-ValueType
low complexity region 123 142 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 239 268 N/A INTRINSIC
SCOP:d1gkub1 280 309 2e-3 SMART
low complexity region 437 452 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 504 511 N/A INTRINSIC
low complexity region 517 532 N/A INTRINSIC
Pfam:zf-MIZ 745 794 2.1e-26 PFAM
low complexity region 873 887 N/A INTRINSIC
low complexity region 988 1003 N/A INTRINSIC
low complexity region 1045 1068 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PIAS (protein inhibitor of activated STAT) family of proteins. The encoded protein regulates the activity of various transcription factors, including the androgen receptor, Smad3/4, and p53. The encoded protein may also play a role in sumoylation. A translocation between this locus on chromosome 10 and the protein tyrosine kinase ABL1 locus on chromosome 9 has been associated with acute lymphoblastic leukemia. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with failure of yolk sac vascular remodeling and abnormal embryonic vascular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg4a G A X: 140,992,840 E106K probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Cdnf T A 2: 3,513,128 M1K probably null Het
Ddx4 T A 13: 112,604,612 K496M probably damaging Het
Dlg1 T C 16: 31,863,197 S779P probably damaging Het
Dtna T A 18: 23,651,503 probably null Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Gal3st2c A T 1: 93,996,400 Q8L possibly damaging Het
Hsd3b1 T C 3: 98,852,778 E299G probably damaging Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Irs4 C A X: 141,724,340 G287W probably damaging Het
Kif21a T C 15: 90,934,464 I1570V probably benign Het
Kremen1 GG GGGCG 11: 5,201,793 probably benign Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mindy4 T C 6: 55,278,100 V521A probably damaging Het
Olfr119 T C 17: 37,700,823 I51T probably damaging Het
Olfr384 A T 11: 73,603,383 T268S probably benign Het
Pdgfrb C T 18: 61,064,016 P175S probably benign Het
Pign C A 1: 105,657,796 L9F possibly damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Ppfia3 C A 7: 45,356,428 R348L probably damaging Het
Prr12 G C 7: 45,046,012 S1343R unknown Het
Psmd13 C A 7: 140,897,740 probably benign Het
Qpct A G 17: 79,070,742 T114A probably damaging Het
Sec24d A G 3: 123,350,746 D624G probably damaging Het
Shank2 A G 7: 144,070,055 Y259C probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Smarcb1 C A 10: 75,897,541 R332L probably damaging Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
St18 T A 1: 6,845,587 C819S probably damaging Het
Tas2r124 A G 6: 132,755,267 N180D possibly damaging Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Tmem204 G A 17: 25,080,333 H71Y probably benign Het
Vmn1r212 A G 13: 22,884,092 S24P probably damaging Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Other mutations in Zmiz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Zmiz1 APN 14 25572070 start codon destroyed probably null 0.53
IGL01582:Zmiz1 APN 14 25658230 missense probably benign 0.00
IGL01601:Zmiz1 APN 14 25581644 missense possibly damaging 0.68
IGL02008:Zmiz1 APN 14 25656879 missense probably damaging 0.97
IGL02395:Zmiz1 APN 14 25656763 missense probably damaging 1.00
IGL02836:Zmiz1 APN 14 25656742 splice site probably benign
zapp UTSW 14 25662980 missense unknown
R0144:Zmiz1 UTSW 14 25655247 missense probably damaging 1.00
R0255:Zmiz1 UTSW 14 25654495 splice site probably benign
R1006:Zmiz1 UTSW 14 25662980 missense unknown
R1160:Zmiz1 UTSW 14 25654512 missense probably damaging 1.00
R1222:Zmiz1 UTSW 14 25658096 splice site probably benign
R4126:Zmiz1 UTSW 14 25656930 missense possibly damaging 0.94
R4373:Zmiz1 UTSW 14 25636010 missense probably damaging 0.97
R4374:Zmiz1 UTSW 14 25636010 missense probably damaging 0.97
R4377:Zmiz1 UTSW 14 25636010 missense probably damaging 0.97
R4533:Zmiz1 UTSW 14 25645660 missense probably damaging 1.00
R4726:Zmiz1 UTSW 14 25643674 critical splice donor site probably null
R5295:Zmiz1 UTSW 14 25656347 missense probably damaging 1.00
R5385:Zmiz1 UTSW 14 25649813 missense probably damaging 1.00
R5579:Zmiz1 UTSW 14 25644856 missense probably damaging 0.96
R5761:Zmiz1 UTSW 14 25651304 missense possibly damaging 0.86
R5761:Zmiz1 UTSW 14 25651306 missense probably damaging 1.00
R5844:Zmiz1 UTSW 14 25656930 missense probably damaging 1.00
R5875:Zmiz1 UTSW 14 25635966 missense possibly damaging 0.55
R6051:Zmiz1 UTSW 14 25572070 start codon destroyed probably null 0.53
R6919:Zmiz1 UTSW 14 25643638 missense probably damaging 1.00
R7083:Zmiz1 UTSW 14 25651948 missense probably damaging 1.00
R7216:Zmiz1 UTSW 14 25576200 frame shift probably null
R7216:Zmiz1 UTSW 14 25576207 missense probably damaging 0.99
R7216:Zmiz1 UTSW 14 25576209 missense probably damaging 0.99
R7233:Zmiz1 UTSW 14 25649668 missense possibly damaging 0.61
X0023:Zmiz1 UTSW 14 25649684 missense probably damaging 0.96
Z1176:Zmiz1 UTSW 14 25645744 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGCCTTGTCATCACTAGTAGC -3'
(R):5'- AACCCTTACCGGTCCATACTG -3'

Sequencing Primer
(F):5'- TGTCATCACTAGTAGCAAGAATAGCC -3'
(R):5'- CGGTCCATACTGGTTTATATCCTTG -3'
Posted On2014-12-04