Incidental Mutation 'R2846:Kif21a'
ID251618
Institutional Source Beutler Lab
Gene Symbol Kif21a
Ensembl Gene ENSMUSG00000022629
Gene Namekinesin family member 21A
SynonymsN-5 kinesin
MMRRC Submission 040439-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2846 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location90933276-91049948 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90934464 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1570 (I1570V)
Ref Sequence ENSEMBL: ENSMUSP00000104911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067205] [ENSMUST00000088614] [ENSMUST00000100304] [ENSMUST00000109287] [ENSMUST00000109288]
Predicted Effect probably benign
Transcript: ENSMUST00000067205
AA Change: I1625V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066911
Gene: ENSMUSG00000022629
AA Change: I1625V

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 9e-9 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
low complexity region 589 628 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
coiled coil region 924 1008 N/A INTRINSIC
coiled coil region 1043 1066 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1251 1271 N/A INTRINSIC
WD40 1290 1327 1.21e-7 SMART
WD40 1330 1368 7.28e-2 SMART
WD40 1394 1432 3.33e-1 SMART
WD40 1435 1477 7e-4 SMART
WD40 1485 1523 2.4e-1 SMART
WD40 1527 1566 1.48e-2 SMART
WD40 1569 1606 2.07e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088614
AA Change: I1669V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000085985
Gene: ENSMUSG00000022629
AA Change: I1669V

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 1e-8 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 564 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
low complexity region 602 641 N/A INTRINSIC
low complexity region 713 726 N/A INTRINSIC
coiled coil region 937 1021 N/A INTRINSIC
coiled coil region 1056 1079 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1271 1283 N/A INTRINSIC
low complexity region 1300 1316 N/A INTRINSIC
WD40 1334 1371 1.21e-7 SMART
WD40 1374 1412 7.28e-2 SMART
WD40 1438 1476 3.33e-1 SMART
WD40 1479 1521 7e-4 SMART
WD40 1529 1567 2.4e-1 SMART
WD40 1571 1610 1.48e-2 SMART
WD40 1613 1650 2.07e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100304
AA Change: I1669V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097877
Gene: ENSMUSG00000022629
AA Change: I1669V

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 1e-8 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 564 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
low complexity region 602 641 N/A INTRINSIC
low complexity region 713 726 N/A INTRINSIC
coiled coil region 937 1021 N/A INTRINSIC
coiled coil region 1056 1079 N/A INTRINSIC
low complexity region 1271 1283 N/A INTRINSIC
low complexity region 1300 1316 N/A INTRINSIC
WD40 1334 1371 1.21e-7 SMART
WD40 1374 1412 7.28e-2 SMART
WD40 1438 1476 3.33e-1 SMART
WD40 1479 1521 7e-4 SMART
WD40 1529 1567 2.4e-1 SMART
WD40 1571 1610 1.48e-2 SMART
WD40 1613 1650 2.07e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109287
AA Change: I1564V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104910
Gene: ENSMUSG00000022629
AA Change: I1564V

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 9e-9 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
low complexity region 589 628 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
coiled coil region 924 1008 N/A INTRINSIC
coiled coil region 1043 1066 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
WD40 1229 1266 1.21e-7 SMART
WD40 1269 1307 7.28e-2 SMART
WD40 1333 1371 3.33e-1 SMART
WD40 1374 1416 7e-4 SMART
WD40 1424 1462 2.4e-1 SMART
WD40 1466 1505 1.48e-2 SMART
WD40 1508 1545 2.07e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109288
AA Change: I1570V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104911
Gene: ENSMUSG00000022629
AA Change: I1570V

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 9e-9 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
low complexity region 589 628 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
coiled coil region 924 1008 N/A INTRINSIC
coiled coil region 1043 1066 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
WD40 1235 1272 1.21e-7 SMART
WD40 1275 1313 7.28e-2 SMART
WD40 1339 1377 3.33e-1 SMART
WD40 1380 1422 7e-4 SMART
WD40 1430 1468 2.4e-1 SMART
WD40 1472 1511 1.48e-2 SMART
WD40 1514 1551 2.07e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000230487
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KIF4 subfamily of kinesin-like motor proteins. The encoded protein is characterized by an N-terminal motor domain a coiled-coil stalk domain and a C-terminal WD-40 repeat domain. This protein may be involved in microtubule dependent transport. Mutations in this gene are the cause of congenital fibrosis of extraocular muscles-1. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg4a G A X: 140,992,840 E106K probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Cdnf T A 2: 3,513,128 M1K probably null Het
Ddx4 T A 13: 112,604,612 K496M probably damaging Het
Dlg1 T C 16: 31,863,197 S779P probably damaging Het
Dtna T A 18: 23,651,503 probably null Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Gal3st2c A T 1: 93,996,400 Q8L possibly damaging Het
Hsd3b1 T C 3: 98,852,778 E299G probably damaging Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Irs4 C A X: 141,724,340 G287W probably damaging Het
Kremen1 GG GGGCG 11: 5,201,793 probably benign Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mindy4 T C 6: 55,278,100 V521A probably damaging Het
Olfr119 T C 17: 37,700,823 I51T probably damaging Het
Olfr384 A T 11: 73,603,383 T268S probably benign Het
Pdgfrb C T 18: 61,064,016 P175S probably benign Het
Pign C A 1: 105,657,796 L9F possibly damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Ppfia3 C A 7: 45,356,428 R348L probably damaging Het
Prr12 G C 7: 45,046,012 S1343R unknown Het
Psmd13 C A 7: 140,897,740 probably benign Het
Qpct A G 17: 79,070,742 T114A probably damaging Het
Sec24d A G 3: 123,350,746 D624G probably damaging Het
Shank2 A G 7: 144,070,055 Y259C probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Smarcb1 C A 10: 75,897,541 R332L probably damaging Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
St18 T A 1: 6,845,587 C819S probably damaging Het
Tas2r124 A G 6: 132,755,267 N180D possibly damaging Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Tmem204 G A 17: 25,080,333 H71Y probably benign Het
Vmn1r212 A G 13: 22,884,092 S24P probably damaging Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zmiz1 A G 14: 25,645,675 S259G probably benign Het
Other mutations in Kif21a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Kif21a APN 15 90937301 missense probably damaging 1.00
IGL01476:Kif21a APN 15 90943864 missense possibly damaging 0.66
IGL01617:Kif21a APN 15 90995637 splice site probably benign
IGL01736:Kif21a APN 15 90959745 missense possibly damaging 0.59
IGL01923:Kif21a APN 15 90956430 missense probably damaging 0.96
IGL01985:Kif21a APN 15 90991767 missense probably damaging 1.00
IGL02304:Kif21a APN 15 90965535 missense probably damaging 1.00
IGL02589:Kif21a APN 15 90985286 missense probably damaging 1.00
IGL03115:Kif21a APN 15 90985395 missense probably damaging 0.99
IGL03211:Kif21a APN 15 90997963 missense possibly damaging 0.73
IGL03372:Kif21a APN 15 90956376 missense probably benign 0.38
reflex UTSW 15 90968358 missense probably null 1.00
R0052:Kif21a UTSW 15 90970857 missense probably damaging 0.98
R0052:Kif21a UTSW 15 90970857 missense probably damaging 0.98
R0304:Kif21a UTSW 15 90976521 splice site probably null
R0378:Kif21a UTSW 15 90969774 splice site probably null
R0420:Kif21a UTSW 15 90968054 unclassified probably benign
R0536:Kif21a UTSW 15 90959683 splice site probably benign
R0826:Kif21a UTSW 15 90997541 critical splice donor site probably null
R0971:Kif21a UTSW 15 90940581 missense possibly damaging 0.46
R1052:Kif21a UTSW 15 90935650 missense probably benign 0.17
R1168:Kif21a UTSW 15 90993753 missense probably damaging 1.00
R1324:Kif21a UTSW 15 90948322 critical splice donor site probably null
R1471:Kif21a UTSW 15 90956419 missense probably benign 0.04
R1625:Kif21a UTSW 15 90942175 missense probably damaging 1.00
R1636:Kif21a UTSW 15 90984805 splice site probably benign
R1647:Kif21a UTSW 15 90994367 missense probably damaging 1.00
R1648:Kif21a UTSW 15 90994367 missense probably damaging 1.00
R1699:Kif21a UTSW 15 90959743 missense probably damaging 0.99
R1703:Kif21a UTSW 15 90949047 intron probably null
R1795:Kif21a UTSW 15 90972727 splice site probably null
R1812:Kif21a UTSW 15 90971766 missense possibly damaging 0.63
R1959:Kif21a UTSW 15 90970848 missense probably damaging 0.99
R1960:Kif21a UTSW 15 90970848 missense probably damaging 0.99
R1961:Kif21a UTSW 15 90970848 missense probably damaging 0.99
R1996:Kif21a UTSW 15 90994371 nonsense probably null
R2230:Kif21a UTSW 15 90985362 nonsense probably null
R2231:Kif21a UTSW 15 90985362 nonsense probably null
R2232:Kif21a UTSW 15 90985362 nonsense probably null
R2424:Kif21a UTSW 15 90971196 missense probably damaging 1.00
R2429:Kif21a UTSW 15 90998005 missense probably damaging 1.00
R2513:Kif21a UTSW 15 90994391 missense possibly damaging 0.96
R3027:Kif21a UTSW 15 90972642 missense probably damaging 0.99
R3624:Kif21a UTSW 15 90965595 missense probably damaging 0.99
R3820:Kif21a UTSW 15 90968074 missense probably benign 0.17
R3923:Kif21a UTSW 15 90937294 missense possibly damaging 0.46
R3962:Kif21a UTSW 15 90985409 missense probably damaging 1.00
R4355:Kif21a UTSW 15 90970833 missense probably benign 0.17
R4516:Kif21a UTSW 15 90971142 missense probably benign 0.38
R4530:Kif21a UTSW 15 90968089 unclassified probably null
R4612:Kif21a UTSW 15 90968223 unclassified probably null
R4674:Kif21a UTSW 15 90940545 missense possibly damaging 0.66
R4675:Kif21a UTSW 15 90940545 missense possibly damaging 0.66
R4698:Kif21a UTSW 15 90956305 missense possibly damaging 0.85
R4712:Kif21a UTSW 15 90984755 missense probably damaging 1.00
R4955:Kif21a UTSW 15 90937190 missense probably damaging 1.00
R4974:Kif21a UTSW 15 90949010 missense probably benign 0.16
R5034:Kif21a UTSW 15 90968358 missense probably null 1.00
R5165:Kif21a UTSW 15 90956376 missense probably benign 0.38
R5464:Kif21a UTSW 15 90993855 missense probably damaging 1.00
R5541:Kif21a UTSW 15 90968113 missense probably damaging 0.99
R5757:Kif21a UTSW 15 90951345 missense probably damaging 1.00
R5936:Kif21a UTSW 15 90935647 missense possibly damaging 0.95
R5976:Kif21a UTSW 15 90935812 missense probably damaging 1.00
R6074:Kif21a UTSW 15 90980892 missense probably benign
R6638:Kif21a UTSW 15 90966407 missense probably damaging 1.00
R6723:Kif21a UTSW 15 90940446 missense probably damaging 0.97
R6785:Kif21a UTSW 15 90935730 missense probably damaging 1.00
R6977:Kif21a UTSW 15 90980837 missense probably damaging 1.00
R7058:Kif21a UTSW 15 90948903 intron probably null
R7147:Kif21a UTSW 15 90980883 missense probably benign 0.13
R7290:Kif21a UTSW 15 90967229 nonsense probably null
R7438:Kif21a UTSW 15 90993796 missense probably benign 0.37
R7593:Kif21a UTSW 15 90943861 missense probably benign 0.03
R7661:Kif21a UTSW 15 90980919 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GCCACAGTAAAAGTGTGATTCAAG -3'
(R):5'- GGGAAGCATTCTATCAATGTTTGC -3'

Sequencing Primer
(F):5'- ATCGATTTTAGGAAGTCTATGTGTTG -3'
(R):5'- CAATGTTTGCTTTTTACTTGCATTC -3'
Posted On2014-12-04