Incidental Mutation 'R2846:Tmem204'
ID251622
Institutional Source Beutler Lab
Gene Symbol Tmem204
Ensembl Gene ENSMUSG00000024168
Gene Nametransmembrane protein 204
Synonyms
MMRRC Submission 040439-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R2846 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25057702-25081181 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25080333 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 71 (H71Y)
Ref Sequence ENSEMBL: ENSMUSP00000024984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000024984] [ENSMUST00000137386] [ENSMUST00000153745]
Predicted Effect probably benign
Transcript: ENSMUST00000024983
SMART Domains Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 8e-17 BLAST
Blast:WD40 510 547 6e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 9e-13 BLAST
Blast:TPR 1011 1044 1e-13 BLAST
Blast:TPR 1377 1410 8e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000024984
AA Change: H71Y

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000024984
Gene: ENSMUSG00000024168
AA Change: H71Y

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
transmembrane domain 102 124 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137386
SMART Domains Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 1e-16 BLAST
Blast:WD40 510 547 5e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 8e-13 BLAST
Blast:TPR 1011 1044 9e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142000
Predicted Effect probably benign
Transcript: ENSMUST00000153745
SMART Domains Protein: ENSMUSP00000119536
Gene: ENSMUSG00000024168

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 42 64 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153895
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] C16ORF30 plays a role in cell adhesion and cellular permeability at adherens junctions (Kearsey et al., 2004 [PubMed 15206924]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice have enlarged lymphatic vessels with an abnormal smooth muscle cell coating. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg4a G A X: 140,992,840 E106K probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Cdnf T A 2: 3,513,128 M1K probably null Het
Ddx4 T A 13: 112,604,612 K496M probably damaging Het
Dlg1 T C 16: 31,863,197 S779P probably damaging Het
Dtna T A 18: 23,651,503 probably null Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Gal3st2c A T 1: 93,996,400 Q8L possibly damaging Het
Hsd3b1 T C 3: 98,852,778 E299G probably damaging Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Irs4 C A X: 141,724,340 G287W probably damaging Het
Kif21a T C 15: 90,934,464 I1570V probably benign Het
Kremen1 GG GGGCG 11: 5,201,793 probably benign Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mindy4 T C 6: 55,278,100 V521A probably damaging Het
Olfr119 T C 17: 37,700,823 I51T probably damaging Het
Olfr384 A T 11: 73,603,383 T268S probably benign Het
Pdgfrb C T 18: 61,064,016 P175S probably benign Het
Pign C A 1: 105,657,796 L9F possibly damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Ppfia3 C A 7: 45,356,428 R348L probably damaging Het
Prr12 G C 7: 45,046,012 S1343R unknown Het
Psmd13 C A 7: 140,897,740 probably benign Het
Qpct A G 17: 79,070,742 T114A probably damaging Het
Sec24d A G 3: 123,350,746 D624G probably damaging Het
Shank2 A G 7: 144,070,055 Y259C probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Smarcb1 C A 10: 75,897,541 R332L probably damaging Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
St18 T A 1: 6,845,587 C819S probably damaging Het
Tas2r124 A G 6: 132,755,267 N180D possibly damaging Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Vmn1r212 A G 13: 22,884,092 S24P probably damaging Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zmiz1 A G 14: 25,645,675 S259G probably benign Het
Other mutations in Tmem204
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Tmem204 APN 17 25070355 missense probably damaging 1.00
R0164:Tmem204 UTSW 17 25058350 missense probably damaging 0.99
R0164:Tmem204 UTSW 17 25058350 missense probably damaging 0.99
R1653:Tmem204 UTSW 17 25080527 missense possibly damaging 0.52
R2165:Tmem204 UTSW 17 25080592 unclassified probably benign
R5416:Tmem204 UTSW 17 25058326 missense probably damaging 1.00
R7447:Tmem204 UTSW 17 25058296 missense probably damaging 0.99
R7631:Tmem204 UTSW 17 25080440 missense probably damaging 1.00
Z1177:Tmem204 UTSW 17 25070341 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGCTGAACAGTGGAGCTCTG -3'
(R):5'- ACTCTCCAGAAGCTTGTGGC -3'

Sequencing Primer
(F):5'- CTCTGTAGCGTTGCTTGTCAG -3'
(R):5'- AGAAGCTTGTGGCCACCG -3'
Posted On2014-12-04