Incidental Mutation 'R2846:Olfr119'
ID251625
Institutional Source Beutler Lab
Gene Symbol Olfr119
Ensembl Gene ENSMUSG00000059964
Gene Nameolfactory receptor 119
SynonymsMOR263-7, GA_x6K02T2PSCP-2159633-2160598
MMRRC Submission 040439-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R2846 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37696564-37702124 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37700823 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 51 (I51T)
Ref Sequence ENSEMBL: ENSMUSP00000150099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080483] [ENSMUST00000213732]
Predicted Effect probably damaging
Transcript: ENSMUST00000080483
AA Change: I51T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092919
Gene: ENSMUSG00000059964
AA Change: I51T

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 5.6e-59 PFAM
Pfam:7TM_GPCR_Srsx 41 311 1.7e-5 PFAM
Pfam:7tm_1 47 296 3.1e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213732
AA Change: I51T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg4a G A X: 140,992,840 E106K probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Cdnf T A 2: 3,513,128 M1K probably null Het
Ddx4 T A 13: 112,604,612 K496M probably damaging Het
Dlg1 T C 16: 31,863,197 S779P probably damaging Het
Dtna T A 18: 23,651,503 probably null Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Gal3st2c A T 1: 93,996,400 Q8L possibly damaging Het
Hsd3b1 T C 3: 98,852,778 E299G probably damaging Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Irs4 C A X: 141,724,340 G287W probably damaging Het
Kif21a T C 15: 90,934,464 I1570V probably benign Het
Kremen1 GG GGGCG 11: 5,201,793 probably benign Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mindy4 T C 6: 55,278,100 V521A probably damaging Het
Olfr384 A T 11: 73,603,383 T268S probably benign Het
Pdgfrb C T 18: 61,064,016 P175S probably benign Het
Pign C A 1: 105,657,796 L9F possibly damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Ppfia3 C A 7: 45,356,428 R348L probably damaging Het
Prr12 G C 7: 45,046,012 S1343R unknown Het
Psmd13 C A 7: 140,897,740 probably benign Het
Qpct A G 17: 79,070,742 T114A probably damaging Het
Sec24d A G 3: 123,350,746 D624G probably damaging Het
Shank2 A G 7: 144,070,055 Y259C probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Smarcb1 C A 10: 75,897,541 R332L probably damaging Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
St18 T A 1: 6,845,587 C819S probably damaging Het
Tas2r124 A G 6: 132,755,267 N180D possibly damaging Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Tmem204 G A 17: 25,080,333 H71Y probably benign Het
Vmn1r212 A G 13: 22,884,092 S24P probably damaging Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zmiz1 A G 14: 25,645,675 S259G probably benign Het
Other mutations in Olfr119
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02209:Olfr119 APN 17 37700992 missense probably damaging 1.00
IGL03339:Olfr119 APN 17 37700791 missense probably damaging 0.99
R0092:Olfr119 UTSW 17 37700805 missense probably damaging 0.98
R0207:Olfr119 UTSW 17 37701058 nonsense probably null
R0378:Olfr119 UTSW 17 37701041 missense probably damaging 1.00
R0408:Olfr119 UTSW 17 37701299 missense probably benign
R0483:Olfr119 UTSW 17 37701297 missense probably benign 0.01
R1595:Olfr119 UTSW 17 37701113 missense probably benign 0.03
R1901:Olfr119 UTSW 17 37701421 missense probably damaging 1.00
R1902:Olfr119 UTSW 17 37701421 missense probably damaging 1.00
R2845:Olfr119 UTSW 17 37700823 missense probably damaging 1.00
R4356:Olfr119 UTSW 17 37700899 missense probably damaging 0.97
R4381:Olfr119 UTSW 17 37700899 missense probably damaging 0.97
R6744:Olfr119 UTSW 17 37701445 nonsense probably null
R7674:Olfr119 UTSW 17 37700682 missense probably benign 0.03
R7677:Olfr119 UTSW 17 37701066 missense probably damaging 1.00
Z1177:Olfr119 UTSW 17 37701053 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTGTCCTTTCTTTCAGGAGATGAG -3'
(R):5'- CAGCGGTCATAAGCCATAGC -3'

Sequencing Primer
(F):5'- CAGGAGATGAGTATCAACTGCTCTC -3'
(R):5'- GCCATAGCTGCCAGTAGACAG -3'
Posted On2014-12-04