Incidental Mutation 'R2846:Dtna'
ID 251628
Institutional Source Beutler Lab
Gene Symbol Dtna
Ensembl Gene ENSMUSG00000024302
Gene Name dystrobrevin alpha
Synonyms a-DB-1, A0, alpha-dystrobrevin, 2210407P21Rik, 87K protein, Dtn, adbn
MMRRC Submission 040439-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.207) question?
Stock # R2846 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 23548192-23792772 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 23784560 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115832] [ENSMUST00000115832] [ENSMUST00000220904] [ENSMUST00000222726]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000115832
SMART Domains Protein: ENSMUSP00000111498
Gene: ENSMUSG00000024302

DomainStartEndE-ValueType
Pfam:EF-hand_2 16 140 1.7e-37 PFAM
Pfam:EF-hand_3 144 232 1.6e-32 PFAM
ZnF_ZZ 237 282 1.29e-17 SMART
SCOP:d1eq1a_ 361 494 5e-3 SMART
low complexity region 499 514 N/A INTRINSIC
coiled coil region 650 677 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115832
SMART Domains Protein: ENSMUSP00000111498
Gene: ENSMUSG00000024302

DomainStartEndE-ValueType
Pfam:EF-hand_2 16 140 1.7e-37 PFAM
Pfam:EF-hand_3 144 232 1.6e-32 PFAM
ZnF_ZZ 237 282 1.29e-17 SMART
SCOP:d1eq1a_ 361 494 5e-3 SMART
low complexity region 499 514 N/A INTRINSIC
coiled coil region 650 677 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220789
Predicted Effect probably null
Transcript: ENSMUST00000220904
Predicted Effect probably benign
Transcript: ENSMUST00000222726
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dystrobrevin subfamily of the dystrophin family. This protein is a component of the dystrophin-associated protein complex (DPC), which consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and alpha- and beta-dystrobrevin. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Mutations in this gene are associated with left ventricular noncompaction with congenital heart defects. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted mutants exhibit skeletal and cardiac myopathies. Neuromuscular junctions appear to form normally, but their postnatal maturation is compromised. Dtna mutations do not increase the severity of Dmd or Utrn mutants whose products are also part of the dystrophin-glycoprotein complex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg4a G A X: 139,893,589 (GRCm39) E106K probably benign Het
Bahd1 G A 2: 118,753,004 (GRCm39) R757H probably damaging Het
Cdnf T A 2: 3,514,165 (GRCm39) M1K probably null Het
Ddx4 T A 13: 112,741,146 (GRCm39) K496M probably damaging Het
Dlg1 T C 16: 31,682,015 (GRCm39) S779P probably damaging Het
Fhad1 G T 4: 141,632,279 (GRCm39) Q1287K probably benign Het
Gal3st2c A T 1: 93,924,122 (GRCm39) Q8L possibly damaging Het
Hsd3b1 T C 3: 98,760,094 (GRCm39) E299G probably damaging Het
Hydin T C 8: 111,245,746 (GRCm39) V2153A probably benign Het
Irs4 C A X: 140,507,336 (GRCm39) G287W probably damaging Het
Kif21a T C 15: 90,818,667 (GRCm39) I1570V probably benign Het
Kremen1 GG GGGCG 11: 5,151,793 (GRCm39) probably benign Het
Mark2 T C 19: 7,264,227 (GRCm39) E116G probably damaging Het
Mfsd13a C T 19: 46,360,431 (GRCm39) R328C probably damaging Het
Mindy4 T C 6: 55,255,085 (GRCm39) V521A probably damaging Het
Or10al3 T C 17: 38,011,714 (GRCm39) I51T probably damaging Het
Or1e25 A T 11: 73,494,209 (GRCm39) T268S probably benign Het
Pdgfrb C T 18: 61,197,088 (GRCm39) P175S probably benign Het
Pign C A 1: 105,585,521 (GRCm39) L9F possibly damaging Het
Plekha1 G T 7: 130,510,095 (GRCm39) W280C probably damaging Het
Ppfia3 C A 7: 45,005,852 (GRCm39) R348L probably damaging Het
Prr12 G C 7: 44,695,436 (GRCm39) S1343R unknown Het
Psmd13 C A 7: 140,477,653 (GRCm39) probably benign Het
Qpct A G 17: 79,378,171 (GRCm39) T114A probably damaging Het
Sec24d A G 3: 123,144,395 (GRCm39) D624G probably damaging Het
Shank2 A G 7: 143,623,792 (GRCm39) Y259C probably damaging Het
Slc15a4 A G 5: 127,681,600 (GRCm39) probably null Het
Smarcb1 C A 10: 75,733,375 (GRCm39) R332L probably damaging Het
Ssh3 T C 19: 4,315,324 (GRCm39) Y338C probably damaging Het
St18 T A 1: 6,915,811 (GRCm39) C819S probably damaging Het
Tas2r124 A G 6: 132,732,230 (GRCm39) N180D possibly damaging Het
Tgfbr3l A G 8: 4,299,280 (GRCm39) D49G probably damaging Het
Tmem204 G A 17: 25,299,307 (GRCm39) H71Y probably benign Het
Vmn1r212 A G 13: 23,068,262 (GRCm39) S24P probably damaging Het
Vmn2r6 A G 3: 64,464,211 (GRCm39) S208P possibly damaging Het
Zbtb8os A T 4: 129,235,309 (GRCm39) E54D probably damaging Het
Zmiz1 A G 14: 25,646,099 (GRCm39) S259G probably benign Het
Other mutations in Dtna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Dtna APN 18 23,730,545 (GRCm39) missense probably benign 0.22
IGL01620:Dtna APN 18 23,758,144 (GRCm39) missense probably damaging 1.00
IGL01705:Dtna APN 18 23,678,788 (GRCm39) missense probably damaging 1.00
IGL01914:Dtna APN 18 23,730,516 (GRCm39) missense possibly damaging 0.62
IGL02388:Dtna APN 18 23,730,571 (GRCm39) missense probably benign 0.00
IGL02427:Dtna APN 18 23,784,595 (GRCm39) missense possibly damaging 0.95
IGL03074:Dtna APN 18 23,735,662 (GRCm39) missense possibly damaging 0.74
R0041:Dtna UTSW 18 23,779,932 (GRCm39) unclassified probably benign
R0041:Dtna UTSW 18 23,779,932 (GRCm39) unclassified probably benign
R0078:Dtna UTSW 18 23,754,499 (GRCm39) missense probably damaging 1.00
R0390:Dtna UTSW 18 23,730,558 (GRCm39) missense probably damaging 1.00
R1808:Dtna UTSW 18 23,702,697 (GRCm39) missense probably damaging 1.00
R1872:Dtna UTSW 18 23,730,617 (GRCm39) critical splice donor site probably null
R2095:Dtna UTSW 18 23,702,805 (GRCm39) missense probably damaging 1.00
R2216:Dtna UTSW 18 23,702,622 (GRCm39) missense probably damaging 1.00
R2295:Dtna UTSW 18 23,764,469 (GRCm39) missense probably damaging 1.00
R2402:Dtna UTSW 18 23,728,535 (GRCm39) nonsense probably null
R3836:Dtna UTSW 18 23,758,159 (GRCm39) missense probably damaging 1.00
R4764:Dtna UTSW 18 23,668,206 (GRCm39) splice site probably null
R4893:Dtna UTSW 18 23,702,724 (GRCm39) missense probably damaging 0.99
R5194:Dtna UTSW 18 23,723,302 (GRCm39) nonsense probably null
R5373:Dtna UTSW 18 23,784,670 (GRCm39) missense probably damaging 1.00
R5374:Dtna UTSW 18 23,784,670 (GRCm39) missense probably damaging 1.00
R5526:Dtna UTSW 18 23,779,287 (GRCm39) missense probably damaging 0.99
R5755:Dtna UTSW 18 23,754,520 (GRCm39) missense probably benign
R5769:Dtna UTSW 18 23,784,611 (GRCm39) missense probably benign 0.27
R6062:Dtna UTSW 18 23,755,113 (GRCm39) missense possibly damaging 0.87
R6413:Dtna UTSW 18 23,755,071 (GRCm39) missense probably damaging 1.00
R6876:Dtna UTSW 18 23,744,167 (GRCm39) missense probably benign 0.00
R7103:Dtna UTSW 18 23,786,436 (GRCm39) critical splice donor site probably null
R7711:Dtna UTSW 18 23,758,253 (GRCm39) critical splice donor site probably null
R7804:Dtna UTSW 18 23,728,666 (GRCm39) missense probably damaging 0.97
R8156:Dtna UTSW 18 23,723,388 (GRCm39) nonsense probably null
R8437:Dtna UTSW 18 23,723,398 (GRCm39) nonsense probably null
R8786:Dtna UTSW 18 23,716,190 (GRCm39) missense probably benign 0.10
R9038:Dtna UTSW 18 23,743,553 (GRCm39) missense probably benign
R9268:Dtna UTSW 18 23,702,643 (GRCm39) missense possibly damaging 0.93
R9416:Dtna UTSW 18 23,780,112 (GRCm39) critical splice donor site probably null
R9578:Dtna UTSW 18 23,728,612 (GRCm39) missense probably damaging 0.98
R9605:Dtna UTSW 18 23,764,454 (GRCm39) missense probably damaging 1.00
R9638:Dtna UTSW 18 23,744,122 (GRCm39) missense probably benign
X0063:Dtna UTSW 18 23,776,225 (GRCm39) missense probably damaging 0.98
X0066:Dtna UTSW 18 23,726,038 (GRCm39) missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GGCCAATGACTTCCACACTAGG -3'
(R):5'- TTAATAGGCAGGACCCCGTG -3'

Sequencing Primer
(F):5'- CTTCCACACTAGGTTTGATTAAAAGG -3'
(R):5'- AGGACCCCGTGGAGGAG -3'
Posted On 2014-12-04