Incidental Mutation 'R2846:Ssh3'
ID251633
Institutional Source Beutler Lab
Gene Symbol Ssh3
Ensembl Gene ENSMUSG00000034616
Gene Nameslingshot protein phosphatase 3
SynonymsSSH-3
MMRRC Submission 040439-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.421) question?
Stock #R2846 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location4261668-4269172 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4265296 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 338 (Y338C)
Ref Sequence ENSEMBL: ENSMUSP00000109483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037992] [ENSMUST00000056888] [ENSMUST00000113852] [ENSMUST00000163858] [ENSMUST00000169192]
Predicted Effect probably damaging
Transcript: ENSMUST00000037992
AA Change: Y334C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047718
Gene: ENSMUSG00000034616
AA Change: Y334C

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Pfam:DEK_C 268 321 3.3e-18 PFAM
DSPc 325 463 7.25e-42 SMART
low complexity region 488 507 N/A INTRINSIC
low complexity region 539 551 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
low complexity region 612 627 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056888
SMART Domains Protein: ENSMUSP00000053783
Gene: ENSMUSG00000005986

DomainStartEndE-ValueType
ANK 39 68 2.77e-3 SMART
ANK 72 101 9.75e1 SMART
Pfam:GPCR_chapero_1 155 469 1.2e-111 PFAM
UIM 482 501 3.2e-2 SMART
UIM 528 547 1.92e2 SMART
UIM 564 583 8.18e0 SMART
UIM 589 605 6e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113852
AA Change: Y338C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109483
Gene: ENSMUSG00000034616
AA Change: Y338C

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Pfam:DEK_C 273 324 1.1e-15 PFAM
DSPc 329 467 7.25e-42 SMART
low complexity region 492 511 N/A INTRINSIC
low complexity region 543 555 N/A INTRINSIC
low complexity region 598 610 N/A INTRINSIC
low complexity region 616 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163858
SMART Domains Protein: ENSMUSP00000128932
Gene: ENSMUSG00000005986

DomainStartEndE-ValueType
ANK 39 68 2.77e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169192
SMART Domains Protein: ENSMUSP00000130995
Gene: ENSMUSG00000005986

DomainStartEndE-ValueType
Blast:ANK 1 28 5e-11 BLAST
Pfam:GPCR_chapero_1 82 121 6.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184641
Meta Mutation Damage Score 0.9499 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The ADF (actin-depolymerizing factor)/cofilin family (see MIM 601442) is composed of stimulus-responsive mediators of actin dynamics. ADF/cofilin proteins are inactivated by kinases such as LIM domain kinase-1 (LIMK1; MIM 601329). The SSH family appears to play a role in actin dynamics by reactivating ADF/cofilin proteins in vivo (Niwa et al., 2002 [PubMed 11832213]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg4a G A X: 140,992,840 E106K probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Cdnf T A 2: 3,513,128 M1K probably null Het
Ddx4 T A 13: 112,604,612 K496M probably damaging Het
Dlg1 T C 16: 31,863,197 S779P probably damaging Het
Dtna T A 18: 23,651,503 probably null Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Gal3st2c A T 1: 93,996,400 Q8L possibly damaging Het
Hsd3b1 T C 3: 98,852,778 E299G probably damaging Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Irs4 C A X: 141,724,340 G287W probably damaging Het
Kif21a T C 15: 90,934,464 I1570V probably benign Het
Kremen1 GG GGGCG 11: 5,201,793 probably benign Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mindy4 T C 6: 55,278,100 V521A probably damaging Het
Olfr119 T C 17: 37,700,823 I51T probably damaging Het
Olfr384 A T 11: 73,603,383 T268S probably benign Het
Pdgfrb C T 18: 61,064,016 P175S probably benign Het
Pign C A 1: 105,657,796 L9F possibly damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Ppfia3 C A 7: 45,356,428 R348L probably damaging Het
Prr12 G C 7: 45,046,012 S1343R unknown Het
Psmd13 C A 7: 140,897,740 probably benign Het
Qpct A G 17: 79,070,742 T114A probably damaging Het
Sec24d A G 3: 123,350,746 D624G probably damaging Het
Shank2 A G 7: 144,070,055 Y259C probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Smarcb1 C A 10: 75,897,541 R332L probably damaging Het
St18 T A 1: 6,845,587 C819S probably damaging Het
Tas2r124 A G 6: 132,755,267 N180D possibly damaging Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Tmem204 G A 17: 25,080,333 H71Y probably benign Het
Vmn1r212 A G 13: 22,884,092 S24P probably damaging Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zmiz1 A G 14: 25,645,675 S259G probably benign Het
Other mutations in Ssh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02455:Ssh3 APN 19 4264432 missense probably damaging 1.00
R0398:Ssh3 UTSW 19 4263699 missense possibly damaging 0.72
R0727:Ssh3 UTSW 19 4263991 missense probably damaging 1.00
R1079:Ssh3 UTSW 19 4266549 missense probably damaging 1.00
R2204:Ssh3 UTSW 19 4269073 missense probably damaging 1.00
R2205:Ssh3 UTSW 19 4269073 missense probably damaging 1.00
R2844:Ssh3 UTSW 19 4265296 missense probably damaging 1.00
R2845:Ssh3 UTSW 19 4265296 missense probably damaging 1.00
R3083:Ssh3 UTSW 19 4262559 missense probably benign
R4436:Ssh3 UTSW 19 4265366 missense probably damaging 1.00
R4916:Ssh3 UTSW 19 4265142 missense probably damaging 1.00
R5837:Ssh3 UTSW 19 4266400 missense probably benign 0.01
R6392:Ssh3 UTSW 19 4265371 missense probably benign 0.03
R6611:Ssh3 UTSW 19 4264422 missense probably damaging 1.00
R6932:Ssh3 UTSW 19 4264420 missense probably damaging 1.00
X0025:Ssh3 UTSW 19 4265707 missense probably benign 0.01
X0028:Ssh3 UTSW 19 4265993 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGTTGGCAGCATTCCACTC -3'
(R):5'- AGTCCCAATCCCTGACTTCAG -3'

Sequencing Primer
(F):5'- ACTCAGAGCCCTGTACAGTG -3'
(R):5'- TGTCCTCAGAGGCTTCACGATG -3'
Posted On2014-12-04