Incidental Mutation 'R2846:Irs4'
ID251645
Institutional Source Beutler Lab
Gene Symbol Irs4
Ensembl Gene ENSMUSG00000054667
Gene Nameinsulin receptor substrate 4
SynonymsIRS-4
MMRRC Submission 040439-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R2846 (G1)
Quality Score225
Status Not validated
ChromosomeX
Chromosomal Location141710998-141725263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 141724340 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 287 (G287W)
Ref Sequence ENSEMBL: ENSMUSP00000067085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067841]
Predicted Effect probably damaging
Transcript: ENSMUST00000067841
AA Change: G287W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067085
Gene: ENSMUSG00000054667
AA Change: G287W

DomainStartEndE-ValueType
low complexity region 11 29 N/A INTRINSIC
low complexity region 63 73 N/A INTRINSIC
PH 80 202 7.95e-8 SMART
low complexity region 211 230 N/A INTRINSIC
IRS 232 334 2.16e-33 SMART
PTBI 232 334 2.11e-56 SMART
low complexity region 351 375 N/A INTRINSIC
low complexity region 397 432 N/A INTRINSIC
low complexity region 487 584 N/A INTRINSIC
low complexity region 595 624 N/A INTRINSIC
low complexity region 720 735 N/A INTRINSIC
low complexity region 736 751 N/A INTRINSIC
low complexity region 773 796 N/A INTRINSIC
low complexity region 1040 1060 N/A INTRINSIC
low complexity region 1082 1113 N/A INTRINSIC
low complexity region 1169 1179 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139874
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit a 10% reduction in male adult size, slightly impaired oral glucose tolerance, and decreased reproductive ability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg4a G A X: 140,992,840 E106K probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Cdnf T A 2: 3,513,128 M1K probably null Het
Ddx4 T A 13: 112,604,612 K496M probably damaging Het
Dlg1 T C 16: 31,863,197 S779P probably damaging Het
Dtna T A 18: 23,651,503 probably null Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Gal3st2c A T 1: 93,996,400 Q8L possibly damaging Het
Hsd3b1 T C 3: 98,852,778 E299G probably damaging Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Kif21a T C 15: 90,934,464 I1570V probably benign Het
Kremen1 GG GGGCG 11: 5,201,793 probably benign Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mindy4 T C 6: 55,278,100 V521A probably damaging Het
Olfr119 T C 17: 37,700,823 I51T probably damaging Het
Olfr384 A T 11: 73,603,383 T268S probably benign Het
Pdgfrb C T 18: 61,064,016 P175S probably benign Het
Pign C A 1: 105,657,796 L9F possibly damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Ppfia3 C A 7: 45,356,428 R348L probably damaging Het
Prr12 G C 7: 45,046,012 S1343R unknown Het
Psmd13 C A 7: 140,897,740 probably benign Het
Qpct A G 17: 79,070,742 T114A probably damaging Het
Sec24d A G 3: 123,350,746 D624G probably damaging Het
Shank2 A G 7: 144,070,055 Y259C probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Smarcb1 C A 10: 75,897,541 R332L probably damaging Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
St18 T A 1: 6,845,587 C819S probably damaging Het
Tas2r124 A G 6: 132,755,267 N180D possibly damaging Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Tmem204 G A 17: 25,080,333 H71Y probably benign Het
Vmn1r212 A G 13: 22,884,092 S24P probably damaging Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zmiz1 A G 14: 25,645,675 S259G probably benign Het
Other mutations in Irs4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Irs4 APN X 141722144 missense unknown
IGL01712:Irs4 APN X 141722399 missense unknown
IGL02366:Irs4 APN X 141723904 missense probably damaging 0.99
IGL03032:Irs4 APN X 141722798 missense unknown
IGL03057:Irs4 APN X 141722528 missense unknown
R0603:Irs4 UTSW X 141725075 missense probably damaging 0.97
R3858:Irs4 UTSW X 141724063 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCTTCTGAGCCAGCCACC -3'
(R):5'- CCTTCTACAAAGATGTGTGGCAG -3'

Sequencing Primer
(F):5'- CCAATACTGATGCTGTAGCTGCG -3'
(R):5'- TGTGGCAGGTAGTAGTGAAACCC -3'
Posted On2014-12-04