Incidental Mutation 'R0311:Tmx4'
ID25165
Institutional Source Beutler Lab
Gene Symbol Tmx4
Ensembl Gene ENSMUSG00000034723
Gene Namethioredoxin-related transmembrane protein 4
Synonyms2810417D04Rik, Txndc13, 4930500L08Rik, D2Bwg1356e
MMRRC Submission 038521-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R0311 (G1)
Quality Score177
Status Validated
Chromosome2
Chromosomal Location134594185-134644145 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to A at 134598526 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Leucine at position 336 (*336L)
Ref Sequence ENSEMBL: ENSMUSP00000045154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038228]
Predicted Effect probably null
Transcript: ENSMUST00000038228
AA Change: *336L
SMART Domains Protein: ENSMUSP00000045154
Gene: ENSMUSG00000034723
AA Change: *336L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin 34 134 5.9e-14 PFAM
transmembrane domain 185 207 N/A INTRINSIC
low complexity region 241 255 N/A INTRINSIC
low complexity region 258 279 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137377
Meta Mutation Damage Score 0.8766 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.6%
  • 20x: 91.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, a catalytically active thioredoxin domain, one transmembrane domain and C-terminal ASP/GLU-rich calcium binding domain. Unlike most members of this gene family, it lacks a C-terminal ER-retention sequence. The encoded protein has been shown to have reductase activity in vitro. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A C 7: 120,402,904 M1547L probably damaging Het
Abcb4 A G 5: 8,934,243 K658E probably benign Het
Abr A G 11: 76,509,127 S15P possibly damaging Het
Adgrb2 G C 4: 130,017,129 A1168P probably damaging Het
Adgre4 A T 17: 55,802,010 E339V probably benign Het
Asprv1 T C 6: 86,628,840 W223R probably damaging Het
Ccdc89 A G 7: 90,426,693 E37G probably damaging Het
Cd48 C A 1: 171,699,580 Y191* probably null Het
Chd4 T C 6: 125,101,665 I257T probably benign Het
Clca4b T C 3: 144,932,496 M2V probably benign Het
Dnah11 A T 12: 118,127,133 D1025E probably benign Het
Erich5 A G 15: 34,472,939 *363W probably null Het
Etl4 A G 2: 20,807,129 D1341G probably damaging Het
Fbxw11 A G 11: 32,722,083 T184A probably benign Het
Fktn A G 4: 53,744,620 Q300R probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gdpd3 G A 7: 126,767,189 R66Q possibly damaging Het
Hexb A G 13: 97,183,819 probably benign Het
Kdm4b A G 17: 56,386,200 R346G probably benign Het
Mbtd1 T A 11: 93,921,357 probably null Het
Med23 T A 10: 24,897,358 C653S possibly damaging Het
Nwd2 A T 5: 63,804,998 I642L probably damaging Het
Olfr1444 A G 19: 12,861,869 I31M probably benign Het
Olfr1448 T A 19: 12,920,096 Y71F possibly damaging Het
Olfr912 T C 9: 38,539,297 V134A probably benign Het
Pbld2 T C 10: 63,054,507 probably null Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Plpp2 C T 10: 79,527,580 R77K probably damaging Het
Pym1 G T 10: 128,765,984 R168L possibly damaging Het
Rbm4 T C 19: 4,787,556 Y300C probably damaging Het
Rnf207 A G 4: 152,315,779 C175R probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Speg T C 1: 75,430,937 V3196A probably damaging Het
Syne1 T A 10: 5,348,943 I1048L possibly damaging Het
Th T C 7: 142,896,041 E41G probably damaging Het
Tnfrsf18 T C 4: 156,026,415 V10A possibly damaging Het
Tnxb A T 17: 34,716,984 I2670F probably damaging Het
Tpx2 T C 2: 152,890,492 V562A probably damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Vps18 T C 2: 119,297,365 Y890H probably benign Het
Ythdc1 G A 5: 86,835,705 D670N probably damaging Het
Other mutations in Tmx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0033:Tmx4 UTSW 2 134600998 splice site probably null
R0033:Tmx4 UTSW 2 134600998 splice site probably null
R0124:Tmx4 UTSW 2 134639720 critical splice donor site probably null
R0844:Tmx4 UTSW 2 134600008 critical splice donor site probably null
R3804:Tmx4 UTSW 2 134620577 missense probably damaging 1.00
R3964:Tmx4 UTSW 2 134600061 missense possibly damaging 0.81
R3966:Tmx4 UTSW 2 134600061 missense possibly damaging 0.81
R4296:Tmx4 UTSW 2 134598629 missense probably benign 0.00
R6011:Tmx4 UTSW 2 134639836 missense probably damaging 1.00
R6241:Tmx4 UTSW 2 134639505 intron probably benign
R6463:Tmx4 UTSW 2 134620639 missense probably damaging 0.98
R6810:Tmx4 UTSW 2 134620674 missense probably damaging 0.98
R6882:Tmx4 UTSW 2 134644002 missense possibly damaging 0.53
R6912:Tmx4 UTSW 2 134598799 missense probably benign 0.06
R7483:Tmx4 UTSW 2 134639661 missense probably benign 0.01
R7545:Tmx4 UTSW 2 134609505 missense possibly damaging 0.89
R7737:Tmx4 UTSW 2 134639668 missense probably benign 0.00
R7857:Tmx4 UTSW 2 134639662 missense probably benign 0.00
R7940:Tmx4 UTSW 2 134639662 missense probably benign 0.00
Z1177:Tmx4 UTSW 2 134598651 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTTTGGCTCCCAAGCACATCAAC -3'
(R):5'- ACAACTTGGCAGGCATCATGGC -3'

Sequencing Primer
(F):5'- TGATGGCTAAGTGCTACACC -3'
(R):5'- CAGGCATCATGGCTGAGG -3'
Posted On2013-04-16