Incidental Mutation 'R2847:Diexf'
ID251652
Institutional Source Beutler Lab
Gene Symbol Diexf
Ensembl Gene ENSMUSG00000016181
Gene Namedigestive organ expansion factor homolog (zebrafish)
SynonymsAA408296
MMRRC Submission 040440-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R2847 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location193091104-193130272 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 193128451 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 81 (N81K)
Ref Sequence ENSEMBL: ENSMUSP00000141676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085555] [ENSMUST00000195291] [ENSMUST00000195848]
Predicted Effect probably benign
Transcript: ENSMUST00000085555
AA Change: N81K

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000082691
Gene: ENSMUSG00000016181
AA Change: N81K

DomainStartEndE-ValueType
low complexity region 51 70 N/A INTRINSIC
coiled coil region 72 113 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 217 224 N/A INTRINSIC
Pfam:UTP25 288 763 6.1e-200 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194335
Predicted Effect probably benign
Transcript: ENSMUST00000195291
AA Change: N81K

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141676
Gene: ENSMUSG00000016181
AA Change: N81K

DomainStartEndE-ValueType
low complexity region 51 70 N/A INTRINSIC
coiled coil region 72 113 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 217 224 N/A INTRINSIC
Pfam:DUF1253 325 634 6.9e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195848
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930510E17Rik T C 9: 53,264,789 noncoding transcript Het
Abca13 T C 11: 9,294,584 V2149A possibly damaging Het
Abca8a T C 11: 110,042,105 D1231G probably damaging Het
Adgrf5 C A 17: 43,422,640 N118K possibly damaging Het
Atxn1 A T 13: 45,566,699 D573E probably damaging Het
Bub3 C T 7: 131,570,884 T326M possibly damaging Het
Cd151 T C 7: 141,469,550 Y57H probably damaging Het
Cib4 T C 5: 30,488,588 N112S probably damaging Het
Cntnap5c A T 17: 57,876,392 D31V probably damaging Het
Cobl A G 11: 12,378,342 L81P probably damaging Het
Cpsf1 A T 15: 76,602,851 L209Q probably damaging Het
Crocc G A 4: 141,018,756 A1684V probably damaging Het
Cyp4f37 T A 17: 32,629,125 C206S probably damaging Het
Defb39 C T 8: 19,052,893 R62H possibly damaging Het
Dnah6 T C 6: 73,129,331 K1756E probably benign Het
Efcab12 A G 6: 115,811,111 I630T probably damaging Het
Erc2 T C 14: 28,040,488 V736A probably damaging Het
Fbf1 C T 11: 116,157,688 probably null Het
Fndc9 C T 11: 46,238,041 A129V probably damaging Het
Foxk2 CGGGGGG CGGGGGGGGG 11: 121,260,491 probably benign Het
Gba2 T C 4: 43,568,000 probably null Het
Gna12 T A 5: 140,785,593 D61V probably damaging Het
Gpr37 C T 6: 25,666,946 probably benign Het
Grin2a A G 16: 9,761,965 F145L possibly damaging Het
Grin2b C A 6: 135,740,953 V714L probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Hmcn1 G T 1: 150,563,599 Y5494* probably null Het
Htr4 T C 18: 62,428,126 S153P probably damaging Het
Igkv9-120 T A 6: 68,050,144 probably benign Het
Itgb6 T C 2: 60,600,535 T772A probably damaging Het
Mgam C A 6: 40,652,715 A86E possibly damaging Het
Mme T A 3: 63,345,199 N421K possibly damaging Het
Mmp1b C T 9: 7,370,763 V331I probably benign Het
Naa16 A G 14: 79,335,883 C816R probably damaging Het
Nav1 G C 1: 135,450,644 probably null Het
Nln A G 13: 104,025,025 M679T probably damaging Het
Olfr353 A G 2: 36,890,524 L108P probably damaging Het
Olfr920 C T 9: 38,756,036 T116I possibly damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Otop3 T C 11: 115,344,558 F339L probably damaging Het
Pax7 T C 4: 139,779,643 D361G possibly damaging Het
Peg10 C T 6: 4,756,912 probably benign Het
Plekhh2 G T 17: 84,597,966 R1096L probably damaging Het
Poteg A T 8: 27,481,676 N406I probably benign Het
Rnf43 T A 11: 87,732,267 N731K probably benign Het
Robo4 C T 9: 37,404,476 R342* probably null Het
Sec23ip G A 7: 128,754,073 V307I probably benign Het
Slc2a4 T A 11: 69,946,171 N116Y probably damaging Het
St5 T C 7: 109,525,337 Q1099R probably damaging Het
Tas1r3 T A 4: 155,860,202 Q854L probably benign Het
Tox3 G A 8: 90,248,390 Q538* probably null Het
Trpm4 A G 7: 45,310,598 F771S probably damaging Het
Tstd3 A T 4: 21,759,375 F132L possibly damaging Het
Ulk2 T C 11: 61,824,729 probably null Het
Unc13b T C 4: 43,180,404 Y3080H probably benign Het
Vmn1r181 G T 7: 23,984,518 S136I possibly damaging Het
Vmn2r114 A T 17: 23,290,974 M844K probably benign Het
Vmn2r60 A T 7: 42,136,433 H220L probably benign Het
Vps13a A G 19: 16,703,599 S1078P probably damaging Het
Vwa8 G T 14: 78,947,142 R360L probably benign Het
Xlr4b A T X: 73,215,332 Q25L probably null Het
Zdhhc22 T A 12: 86,988,562 T39S probably benign Het
Zfp532 T A 18: 65,656,626 H1045Q possibly damaging Het
Zfp773 AGCTGCTGCTGCTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTGC 7: 7,133,093 probably benign Het
Zfp964 G C 8: 69,663,854 C368S unknown Het
Zfp985 G A 4: 147,583,011 W112* probably null Het
Other mutations in Diexf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Diexf APN 1 193115001 missense probably damaging 1.00
IGL01700:Diexf APN 1 193118265 missense probably damaging 1.00
IGL02076:Diexf APN 1 193130059 missense probably damaging 1.00
IGL02121:Diexf APN 1 193118278 missense probably benign 0.05
IGL02666:Diexf APN 1 193107596 nonsense probably null
IGL02997:Diexf APN 1 193120584 missense probably benign 0.34
3-1:Diexf UTSW 1 193118280 missense probably benign 0.07
R0099:Diexf UTSW 1 193128470 missense probably damaging 1.00
R0395:Diexf UTSW 1 193123676 missense possibly damaging 0.69
R0502:Diexf UTSW 1 193114828 splice site probably benign
R0973:Diexf UTSW 1 193114703 missense probably damaging 0.98
R0973:Diexf UTSW 1 193114703 missense probably damaging 0.98
R0974:Diexf UTSW 1 193114703 missense probably damaging 0.98
R1815:Diexf UTSW 1 193118283 missense probably benign 0.26
R1930:Diexf UTSW 1 193118309 missense probably damaging 1.00
R1931:Diexf UTSW 1 193118309 missense probably damaging 1.00
R1937:Diexf UTSW 1 193122093 missense probably damaging 1.00
R2848:Diexf UTSW 1 193128451 missense probably benign 0.41
R3412:Diexf UTSW 1 193128502 missense possibly damaging 0.93
R3414:Diexf UTSW 1 193128502 missense possibly damaging 0.93
R4471:Diexf UTSW 1 193130137 missense possibly damaging 0.68
R4627:Diexf UTSW 1 193107695 missense probably benign 0.00
R4644:Diexf UTSW 1 193128480 missense probably damaging 1.00
R4761:Diexf UTSW 1 193113922 missense probably damaging 1.00
R4791:Diexf UTSW 1 193128267 missense probably benign
R4793:Diexf UTSW 1 193113808 missense probably null 0.56
R4858:Diexf UTSW 1 193113764 missense probably damaging 1.00
R4944:Diexf UTSW 1 193114954 missense probably damaging 1.00
R5162:Diexf UTSW 1 193113781 missense probably damaging 1.00
R5347:Diexf UTSW 1 193128379 missense probably benign
R5837:Diexf UTSW 1 193118393 missense probably damaging 1.00
R6113:Diexf UTSW 1 193129502 missense probably null 0.01
R6455:Diexf UTSW 1 193128376 missense probably benign 0.07
R6563:Diexf UTSW 1 193118390 missense probably damaging 1.00
R6636:Diexf UTSW 1 193113767 missense probably damaging 1.00
R7018:Diexf UTSW 1 193114855 missense probably benign 0.06
R7037:Diexf UTSW 1 193120723 splice site probably null
R8027:Diexf UTSW 1 193118222 missense probably benign
R8042:Diexf UTSW 1 193114672 missense
RF021:Diexf UTSW 1 193120666 missense probably benign
X0050:Diexf UTSW 1 193123732 missense probably benign 0.23
Z1177:Diexf UTSW 1 193114675 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTTCCTGTGTCTCAGCAG -3'
(R):5'- AGTAGCGGGTTTCCTAAGGAC -3'

Sequencing Primer
(F):5'- GTGTCTCAGCAGCCTCCTCAG -3'
(R):5'- CGGGTTTCCTAAGGACTTTTCCAG -3'
Posted On2014-12-04