Incidental Mutation 'R2847:Tas1r3'
ID251672
Institutional Source Beutler Lab
Gene Symbol Tas1r3
Ensembl Gene ENSMUSG00000029072
Gene Nametaste receptor, type 1, member 3
SynonymsT1r3
MMRRC Submission 040440-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R2847 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location155859268-155863362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 155860202 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 854 (Q854L)
Ref Sequence ENSEMBL: ENSMUSP00000030949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030948] [ENSMUST00000030949] [ENSMUST00000030950] [ENSMUST00000168552]
Predicted Effect probably benign
Transcript: ENSMUST00000030948
SMART Domains Protein: ENSMUSP00000030948
Gene: ENSMUSG00000029071

DomainStartEndE-ValueType
DAX 1 85 2.17e-52 SMART
Pfam:Dishevelled 144 215 1.1e-31 PFAM
low complexity region 217 233 N/A INTRINSIC
low complexity region 235 246 N/A INTRINSIC
PDZ 260 339 3.13e-16 SMART
low complexity region 380 397 N/A INTRINSIC
DEP 425 499 1.47e-26 SMART
Pfam:Dsh_C 503 685 4.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030949
AA Change: Q854L

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000030949
Gene: ENSMUSG00000029072
AA Change: Q854L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 72 469 2e-79 PFAM
Pfam:NCD3G 500 552 1.9e-16 PFAM
Pfam:7tm_3 576 821 9.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030950
SMART Domains Protein: ENSMUSP00000030950
Gene: ENSMUSG00000029073

DomainStartEndE-ValueType
Pfam:GLTP 27 179 1.4e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156997
Predicted Effect probably benign
Transcript: ENSMUST00000168552
SMART Domains Protein: ENSMUSP00000133137
Gene: ENSMUSG00000029071

DomainStartEndE-ValueType
DAX 1 85 2.17e-52 SMART
Pfam:Dishevelled 90 247 1.7e-60 PFAM
PDZ 260 339 3.13e-16 SMART
low complexity region 380 397 N/A INTRINSIC
DEP 425 499 1.47e-26 SMART
Pfam:Dsh_C 503 685 7.6e-59 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor involved in taste responses. The encoded protein can form a heterodimeric receptor with TAS1R1 to elicit the umami taste response, or it can bind with TAS1R2 to form a receptor for the sweet taste response. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutation of this locus affects taste perception. Complete inactivation results in diminished behavioral and nervous repsonses to both sweet and umami tastants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930510E17Rik T C 9: 53,264,789 noncoding transcript Het
Abca13 T C 11: 9,294,584 V2149A possibly damaging Het
Abca8a T C 11: 110,042,105 D1231G probably damaging Het
Adgrf5 C A 17: 43,422,640 N118K possibly damaging Het
Atxn1 A T 13: 45,566,699 D573E probably damaging Het
Bub3 C T 7: 131,570,884 T326M possibly damaging Het
Cd151 T C 7: 141,469,550 Y57H probably damaging Het
Cib4 T C 5: 30,488,588 N112S probably damaging Het
Cntnap5c A T 17: 57,876,392 D31V probably damaging Het
Cobl A G 11: 12,378,342 L81P probably damaging Het
Cpsf1 A T 15: 76,602,851 L209Q probably damaging Het
Crocc G A 4: 141,018,756 A1684V probably damaging Het
Cyp4f37 T A 17: 32,629,125 C206S probably damaging Het
Defb39 C T 8: 19,052,893 R62H possibly damaging Het
Diexf A T 1: 193,128,451 N81K probably benign Het
Dnah6 T C 6: 73,129,331 K1756E probably benign Het
Efcab12 A G 6: 115,811,111 I630T probably damaging Het
Erc2 T C 14: 28,040,488 V736A probably damaging Het
Fbf1 C T 11: 116,157,688 probably null Het
Fndc9 C T 11: 46,238,041 A129V probably damaging Het
Foxk2 CGGGGGG CGGGGGGGGG 11: 121,260,491 probably benign Het
Gba2 T C 4: 43,568,000 probably null Het
Gna12 T A 5: 140,785,593 D61V probably damaging Het
Gpr37 C T 6: 25,666,946 probably benign Het
Grin2a A G 16: 9,761,965 F145L possibly damaging Het
Grin2b C A 6: 135,740,953 V714L probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Hmcn1 G T 1: 150,563,599 Y5494* probably null Het
Htr4 T C 18: 62,428,126 S153P probably damaging Het
Igkv9-120 T A 6: 68,050,144 probably benign Het
Itgb6 T C 2: 60,600,535 T772A probably damaging Het
Mgam C A 6: 40,652,715 A86E possibly damaging Het
Mme T A 3: 63,345,199 N421K possibly damaging Het
Mmp1b C T 9: 7,370,763 V331I probably benign Het
Naa16 A G 14: 79,335,883 C816R probably damaging Het
Nav1 G C 1: 135,450,644 probably null Het
Nln A G 13: 104,025,025 M679T probably damaging Het
Olfr353 A G 2: 36,890,524 L108P probably damaging Het
Olfr920 C T 9: 38,756,036 T116I possibly damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Otop3 T C 11: 115,344,558 F339L probably damaging Het
Pax7 T C 4: 139,779,643 D361G possibly damaging Het
Peg10 C T 6: 4,756,912 probably benign Het
Plekhh2 G T 17: 84,597,966 R1096L probably damaging Het
Poteg A T 8: 27,481,676 N406I probably benign Het
Rnf43 T A 11: 87,732,267 N731K probably benign Het
Robo4 C T 9: 37,404,476 R342* probably null Het
Sec23ip G A 7: 128,754,073 V307I probably benign Het
Slc2a4 T A 11: 69,946,171 N116Y probably damaging Het
St5 T C 7: 109,525,337 Q1099R probably damaging Het
Tox3 G A 8: 90,248,390 Q538* probably null Het
Trpm4 A G 7: 45,310,598 F771S probably damaging Het
Tstd3 A T 4: 21,759,375 F132L possibly damaging Het
Ulk2 T C 11: 61,824,729 probably null Het
Unc13b T C 4: 43,180,404 Y3080H probably benign Het
Vmn1r181 G T 7: 23,984,518 S136I possibly damaging Het
Vmn2r114 A T 17: 23,290,974 M844K probably benign Het
Vmn2r60 A T 7: 42,136,433 H220L probably benign Het
Vps13a A G 19: 16,703,599 S1078P probably damaging Het
Vwa8 G T 14: 78,947,142 R360L probably benign Het
Xlr4b A T X: 73,215,332 Q25L probably null Het
Zdhhc22 T A 12: 86,988,562 T39S probably benign Het
Zfp532 T A 18: 65,656,626 H1045Q possibly damaging Het
Zfp773 AGCTGCTGCTGCTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTGC 7: 7,133,093 probably benign Het
Zfp964 G C 8: 69,663,854 C368S unknown Het
Zfp985 G A 4: 147,583,011 W112* probably null Het
Other mutations in Tas1r3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Tas1r3 APN 4 155861327 missense probably benign 0.43
IGL01587:Tas1r3 APN 4 155861359 missense probably damaging 0.99
IGL02314:Tas1r3 APN 4 155860662 missense probably damaging 1.00
IGL02747:Tas1r3 APN 4 155860460 missense possibly damaging 0.92
IGL02999:Tas1r3 APN 4 155862359 missense probably damaging 0.97
IGL03026:Tas1r3 APN 4 155861843 unclassified probably benign
IGL03407:Tas1r3 APN 4 155861982 unclassified probably null
R0122:Tas1r3 UTSW 4 155860833 missense probably benign
R0827:Tas1r3 UTSW 4 155860869 missense probably benign 0.02
R1700:Tas1r3 UTSW 4 155861570 missense probably benign
R1803:Tas1r3 UTSW 4 155860470 missense probably damaging 0.99
R1804:Tas1r3 UTSW 4 155860470 missense probably damaging 0.99
R1883:Tas1r3 UTSW 4 155862153 missense probably damaging 1.00
R1998:Tas1r3 UTSW 4 155862920 missense probably damaging 1.00
R2061:Tas1r3 UTSW 4 155860470 missense probably damaging 0.99
R2104:Tas1r3 UTSW 4 155862131 missense probably benign 0.26
R2127:Tas1r3 UTSW 4 155860470 missense probably damaging 0.99
R2129:Tas1r3 UTSW 4 155860470 missense probably damaging 0.99
R2237:Tas1r3 UTSW 4 155862218 missense possibly damaging 0.58
R2316:Tas1r3 UTSW 4 155863315 missense probably benign
R3619:Tas1r3 UTSW 4 155860953 missense probably damaging 0.99
R3870:Tas1r3 UTSW 4 155861353 missense probably damaging 1.00
R4194:Tas1r3 UTSW 4 155862985 missense probably damaging 1.00
R4195:Tas1r3 UTSW 4 155862985 missense probably damaging 1.00
R4420:Tas1r3 UTSW 4 155862332 missense probably damaging 0.99
R5577:Tas1r3 UTSW 4 155862065 missense probably benign 0.36
R6734:Tas1r3 UTSW 4 155860800 missense probably damaging 1.00
R7006:Tas1r3 UTSW 4 155862904 missense possibly damaging 0.93
R7231:Tas1r3 UTSW 4 155862826 missense probably damaging 1.00
R7490:Tas1r3 UTSW 4 155862023 missense probably damaging 0.97
R7895:Tas1r3 UTSW 4 155862548 missense probably damaging 1.00
R7978:Tas1r3 UTSW 4 155862548 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTAGGTGGGCATAATAGGATC -3'
(R):5'- TGTGCAGATGGGTGCTATCC -3'

Sequencing Primer
(F):5'- ATAGGGTCCATCTTGTGCAC -3'
(R):5'- CAGATGGGTGCTATCCTAGTC -3'
Posted On2014-12-04