Incidental Mutation 'R2847:Mmp1b'
ID251718
Institutional Source Beutler Lab
Gene Symbol Mmp1b
Ensembl Gene ENSMUSG00000041620
Gene Namematrix metallopeptidase 1b (interstitial collagenase)
SynonymsMcol-B
MMRRC Submission 040440-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R2847 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location7368239-7388047 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 7370763 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 331 (V331I)
Ref Sequence ENSEMBL: ENSMUSP00000047261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047888] [ENSMUST00000065079]
Predicted Effect probably benign
Transcript: ENSMUST00000047888
AA Change: V331I

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000047261
Gene: ENSMUSG00000041620
AA Change: V331I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:PG_binding_1 26 84 1.4e-13 PFAM
ZnMc 102 260 3.08e-46 SMART
HX 281 323 4.39e-2 SMART
HX 325 369 3.51e-10 SMART
HX 374 421 1.03e-16 SMART
HX 423 463 1.6e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065079
SMART Domains Protein: ENSMUSP00000065291
Gene: ENSMUSG00000049723

DomainStartEndE-ValueType
Pfam:PG_binding_1 30 91 6.5e-22 PFAM
ZnMc 109 268 1.23e-54 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930510E17Rik T C 9: 53,264,789 noncoding transcript Het
Abca13 T C 11: 9,294,584 V2149A possibly damaging Het
Abca8a T C 11: 110,042,105 D1231G probably damaging Het
Adgrf5 C A 17: 43,422,640 N118K possibly damaging Het
Atxn1 A T 13: 45,566,699 D573E probably damaging Het
Bub3 C T 7: 131,570,884 T326M possibly damaging Het
Cd151 T C 7: 141,469,550 Y57H probably damaging Het
Cib4 T C 5: 30,488,588 N112S probably damaging Het
Cntnap5c A T 17: 57,876,392 D31V probably damaging Het
Cobl A G 11: 12,378,342 L81P probably damaging Het
Cpsf1 A T 15: 76,602,851 L209Q probably damaging Het
Crocc G A 4: 141,018,756 A1684V probably damaging Het
Cyp4f37 T A 17: 32,629,125 C206S probably damaging Het
Defb39 C T 8: 19,052,893 R62H possibly damaging Het
Diexf A T 1: 193,128,451 N81K probably benign Het
Dnah6 T C 6: 73,129,331 K1756E probably benign Het
Efcab12 A G 6: 115,811,111 I630T probably damaging Het
Erc2 T C 14: 28,040,488 V736A probably damaging Het
Fbf1 C T 11: 116,157,688 probably null Het
Fndc9 C T 11: 46,238,041 A129V probably damaging Het
Foxk2 CGGGGGG CGGGGGGGGG 11: 121,260,491 probably benign Het
Gba2 T C 4: 43,568,000 probably null Het
Gna12 T A 5: 140,785,593 D61V probably damaging Het
Gpr37 C T 6: 25,666,946 probably benign Het
Grin2a A G 16: 9,761,965 F145L possibly damaging Het
Grin2b C A 6: 135,740,953 V714L probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Hmcn1 G T 1: 150,563,599 Y5494* probably null Het
Htr4 T C 18: 62,428,126 S153P probably damaging Het
Igkv9-120 T A 6: 68,050,144 probably benign Het
Itgb6 T C 2: 60,600,535 T772A probably damaging Het
Mgam C A 6: 40,652,715 A86E possibly damaging Het
Mme T A 3: 63,345,199 N421K possibly damaging Het
Naa16 A G 14: 79,335,883 C816R probably damaging Het
Nav1 G C 1: 135,450,644 probably null Het
Nln A G 13: 104,025,025 M679T probably damaging Het
Olfr353 A G 2: 36,890,524 L108P probably damaging Het
Olfr920 C T 9: 38,756,036 T116I possibly damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Otop3 T C 11: 115,344,558 F339L probably damaging Het
Pax7 T C 4: 139,779,643 D361G possibly damaging Het
Peg10 C T 6: 4,756,912 probably benign Het
Plekhh2 G T 17: 84,597,966 R1096L probably damaging Het
Poteg A T 8: 27,481,676 N406I probably benign Het
Rnf43 T A 11: 87,732,267 N731K probably benign Het
Robo4 C T 9: 37,404,476 R342* probably null Het
Sec23ip G A 7: 128,754,073 V307I probably benign Het
Slc2a4 T A 11: 69,946,171 N116Y probably damaging Het
St5 T C 7: 109,525,337 Q1099R probably damaging Het
Tas1r3 T A 4: 155,860,202 Q854L probably benign Het
Tox3 G A 8: 90,248,390 Q538* probably null Het
Trpm4 A G 7: 45,310,598 F771S probably damaging Het
Tstd3 A T 4: 21,759,375 F132L possibly damaging Het
Ulk2 T C 11: 61,824,729 probably null Het
Unc13b T C 4: 43,180,404 Y3080H probably benign Het
Vmn1r181 G T 7: 23,984,518 S136I possibly damaging Het
Vmn2r114 A T 17: 23,290,974 M844K probably benign Het
Vmn2r60 A T 7: 42,136,433 H220L probably benign Het
Vps13a A G 19: 16,703,599 S1078P probably damaging Het
Vwa8 G T 14: 78,947,142 R360L probably benign Het
Xlr4b A T X: 73,215,332 Q25L probably null Het
Zdhhc22 T A 12: 86,988,562 T39S probably benign Het
Zfp532 T A 18: 65,656,626 H1045Q possibly damaging Het
Zfp773 AGCTGCTGCTGCTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTGC 7: 7,133,093 probably benign Het
Zfp964 G C 8: 69,663,854 C368S unknown Het
Zfp985 G A 4: 147,583,011 W112* probably null Het
Other mutations in Mmp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Mmp1b APN 9 7387946 missense probably benign 0.00
IGL00339:Mmp1b APN 9 7368304 missense probably benign 0.19
IGL00832:Mmp1b APN 9 7387023 missense possibly damaging 0.81
IGL01110:Mmp1b APN 9 7384921 missense probably benign 0.02
IGL02121:Mmp1b APN 9 7384935 missense probably benign 0.22
IGL02143:Mmp1b APN 9 7386400 missense probably benign 0.10
IGL02698:Mmp1b APN 9 7384877 missense probably damaging 1.00
IGL02928:Mmp1b APN 9 7368242 makesense probably null
IGL03218:Mmp1b APN 9 7387907 missense probably benign 0.07
IGL03304:Mmp1b APN 9 7384701 missense probably damaging 1.00
IGL02802:Mmp1b UTSW 9 7384709 missense probably benign 0.08
R0122:Mmp1b UTSW 9 7386689 missense probably damaging 0.99
R0506:Mmp1b UTSW 9 7387013 missense possibly damaging 0.52
R0600:Mmp1b UTSW 9 7387947 missense possibly damaging 0.55
R1454:Mmp1b UTSW 9 7386693 missense probably damaging 1.00
R1466:Mmp1b UTSW 9 7384779 splice site probably benign
R1696:Mmp1b UTSW 9 7386699 missense probably damaging 0.99
R1837:Mmp1b UTSW 9 7386409 missense probably damaging 1.00
R1986:Mmp1b UTSW 9 7368577 missense probably benign 0.01
R2031:Mmp1b UTSW 9 7368607 missense possibly damaging 0.68
R2098:Mmp1b UTSW 9 7386984 missense probably benign 0.03
R2107:Mmp1b UTSW 9 7369310 missense probably damaging 1.00
R2870:Mmp1b UTSW 9 7386875 synonymous silent
R3944:Mmp1b UTSW 9 7384708 missense possibly damaging 0.73
R4654:Mmp1b UTSW 9 7370849 missense probably benign 0.18
R4829:Mmp1b UTSW 9 7370729 critical splice donor site probably null
R5329:Mmp1b UTSW 9 7384897 missense possibly damaging 0.61
R5332:Mmp1b UTSW 9 7384897 missense possibly damaging 0.61
R5333:Mmp1b UTSW 9 7384897 missense possibly damaging 0.61
R5418:Mmp1b UTSW 9 7384897 missense possibly damaging 0.61
R5419:Mmp1b UTSW 9 7384897 missense possibly damaging 0.61
R5420:Mmp1b UTSW 9 7384897 missense possibly damaging 0.61
R6053:Mmp1b UTSW 9 7385031 missense probably benign 0.07
R6394:Mmp1b UTSW 9 7386316 missense probably benign 0.20
R6774:Mmp1b UTSW 9 7387914 missense probably benign 0.00
R6842:Mmp1b UTSW 9 7384888 missense probably damaging 1.00
R7092:Mmp1b UTSW 9 7386981 missense probably damaging 1.00
R7146:Mmp1b UTSW 9 7385014 missense probably damaging 1.00
R7549:Mmp1b UTSW 9 7384753 missense probably benign 0.21
R7658:Mmp1b UTSW 9 7386675 missense possibly damaging 0.59
Z1177:Mmp1b UTSW 9 7369322 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACTAAGTGGATGGACTCACATTAAC -3'
(R):5'- GCAGAAACCTTCATGCCTTACC -3'

Sequencing Primer
(F):5'- GGATGGACTCACATTAACTTACTTGG -3'
(R):5'- TAGACATTTGCTGACAGGACC -3'
Posted On2014-12-04