Incidental Mutation 'R0311:Fktn'
ID25174
Institutional Source Beutler Lab
Gene Symbol Fktn
Ensembl Gene ENSMUSG00000028414
Gene Namefukutin
SynonymsFukutin, Fcmd
MMRRC Submission 038521-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0311 (G1)
Quality Score208
Status Validated
Chromosome4
Chromosomal Location53713998-53777890 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53744620 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 300 (Q300R)
Ref Sequence ENSEMBL: ENSMUSP00000152867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061771] [ENSMUST00000107638] [ENSMUST00000128667] [ENSMUST00000221657] [ENSMUST00000222290]
Predicted Effect probably benign
Transcript: ENSMUST00000061771
AA Change: Q261R

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000061489
Gene: ENSMUSG00000028414
AA Change: Q261R

DomainStartEndE-ValueType
transmembrane domain 7 28 N/A INTRINSIC
Pfam:LicD 288 393 2.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107638
SMART Domains Protein: ENSMUSP00000138774
Gene: ENSMUSG00000028414

DomainStartEndE-ValueType
transmembrane domain 7 28 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128667
AA Change: Q261R

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000114699
Gene: ENSMUSG00000028414
AA Change: Q261R

DomainStartEndE-ValueType
transmembrane domain 7 28 N/A INTRINSIC
Pfam:LicD 288 393 2.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221657
AA Change: Q300R

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000222290
Meta Mutation Damage Score 0.1478 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.6%
  • 20x: 91.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative transmembrane protein that is localized to the cis-Golgi compartment, where it may be involved in the glycosylation of alpha-dystroglycan in skeletal muscle. The encoded protein is thought to be a glycosyltransferase and could play a role in brain development. Defects in this gene are a cause of Fukuyama-type congenital muscular dystrophy (FCMD), Walker-Warburg syndrome (WWS), limb-girdle muscular dystrophy type 2M (LGMD2M), and dilated cardiomyopathy type 1X (CMD1X). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null mice die by E9.5. Embryos exhibit diverse phenotypes such as growth retardation, folding of the egg cylinder, leakage of maternal red blood cells into the yolk sac cavity, increased number of apoptotic cells in the ectoderm, and thin and breached basement membranes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A C 7: 120,402,904 M1547L probably damaging Het
Abcb4 A G 5: 8,934,243 K658E probably benign Het
Abr A G 11: 76,509,127 S15P possibly damaging Het
Adgrb2 G C 4: 130,017,129 A1168P probably damaging Het
Adgre4 A T 17: 55,802,010 E339V probably benign Het
Asprv1 T C 6: 86,628,840 W223R probably damaging Het
Ccdc89 A G 7: 90,426,693 E37G probably damaging Het
Cd48 C A 1: 171,699,580 Y191* probably null Het
Chd4 T C 6: 125,101,665 I257T probably benign Het
Clca4b T C 3: 144,932,496 M2V probably benign Het
Dnah11 A T 12: 118,127,133 D1025E probably benign Het
Erich5 A G 15: 34,472,939 *363W probably null Het
Etl4 A G 2: 20,807,129 D1341G probably damaging Het
Fbxw11 A G 11: 32,722,083 T184A probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gdpd3 G A 7: 126,767,189 R66Q possibly damaging Het
Hexb A G 13: 97,183,819 probably benign Het
Kdm4b A G 17: 56,386,200 R346G probably benign Het
Mbtd1 T A 11: 93,921,357 probably null Het
Med23 T A 10: 24,897,358 C653S possibly damaging Het
Nwd2 A T 5: 63,804,998 I642L probably damaging Het
Olfr1444 A G 19: 12,861,869 I31M probably benign Het
Olfr1448 T A 19: 12,920,096 Y71F possibly damaging Het
Olfr912 T C 9: 38,539,297 V134A probably benign Het
Pbld2 T C 10: 63,054,507 probably null Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Plpp2 C T 10: 79,527,580 R77K probably damaging Het
Pym1 G T 10: 128,765,984 R168L possibly damaging Het
Rbm4 T C 19: 4,787,556 Y300C probably damaging Het
Rnf207 A G 4: 152,315,779 C175R probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Speg T C 1: 75,430,937 V3196A probably damaging Het
Syne1 T A 10: 5,348,943 I1048L possibly damaging Het
Th T C 7: 142,896,041 E41G probably damaging Het
Tmx4 T A 2: 134,598,526 *336L probably null Het
Tnfrsf18 T C 4: 156,026,415 V10A possibly damaging Het
Tnxb A T 17: 34,716,984 I2670F probably damaging Het
Tpx2 T C 2: 152,890,492 V562A probably damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Vps18 T C 2: 119,297,365 Y890H probably benign Het
Ythdc1 G A 5: 86,835,705 D670N probably damaging Het
Other mutations in Fktn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Fktn APN 4 53734866 missense probably benign 0.17
IGL00562:Fktn APN 4 53747007 critical splice acceptor site probably null
IGL00563:Fktn APN 4 53747007 critical splice acceptor site probably null
IGL00972:Fktn APN 4 53734992 missense probably damaging 1.00
IGL01025:Fktn APN 4 53737568 missense possibly damaging 0.51
IGL02329:Fktn APN 4 53720181 missense probably benign 0.40
IGL03149:Fktn APN 4 53744653 missense probably benign
IGL03310:Fktn APN 4 53720120 nonsense probably null
beijing UTSW 4 53734880 missense probably damaging 1.00
R0257:Fktn UTSW 4 53734898 missense probably benign 0.09
R1368:Fktn UTSW 4 53734880 missense probably damaging 1.00
R1500:Fktn UTSW 4 53735065 missense probably benign
R1654:Fktn UTSW 4 53761220 missense probably benign 0.01
R1757:Fktn UTSW 4 53747003 splice site probably benign
R2007:Fktn UTSW 4 53735099 missense possibly damaging 0.56
R4308:Fktn UTSW 4 53724617 intron probably benign
R4374:Fktn UTSW 4 53720201 missense probably damaging 0.99
R4798:Fktn UTSW 4 53744637 missense probably benign 0.01
R5563:Fktn UTSW 4 53761327 missense probably damaging 1.00
R5913:Fktn UTSW 4 53735035 nonsense probably null
R5997:Fktn UTSW 4 53735061 missense probably benign 0.00
R6227:Fktn UTSW 4 53731136 missense probably benign
R6942:Fktn UTSW 4 53735128 critical splice donor site probably null
R7832:Fktn UTSW 4 53734859 missense probably benign
R7915:Fktn UTSW 4 53734859 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGAGGCTAACACTTGGTGTCTTCC -3'
(R):5'- TGCCTGATTACCACAAGCATTTACTCC -3'

Sequencing Primer
(F):5'- acacacaccaacactccc -3'
(R):5'- GCATTTACTCCTAAAGCCAGAG -3'
Posted On2013-04-16