Incidental Mutation 'R2509:Car11'
ID251748
Institutional Source Beutler Lab
Gene Symbol Car11
Ensembl Gene ENSMUSG00000003273
Gene Namecarbonic anhydrase 11
SynonymsCA-RP XI
MMRRC Submission 040415-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R2509 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45699843-45704682 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45701359 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 93 (G93E)
Ref Sequence ENSEMBL: ENSMUSP00000003360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003360] [ENSMUST00000080885] [ENSMUST00000211357] [ENSMUST00000211513]
Predicted Effect probably damaging
Transcript: ENSMUST00000003360
AA Change: G93E

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000003360
Gene: ENSMUSG00000003273
AA Change: G93E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Carb_anhydrase 35 303 1.1e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080885
SMART Domains Protein: ENSMUSP00000079693
Gene: ENSMUSG00000059824

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
low complexity region 71 98 N/A INTRINSIC
low complexity region 127 171 N/A INTRINSIC
BRLZ 253 317 5.17e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126106
AA Change: E109K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137294
AA Change: G115E
Predicted Effect unknown
Transcript: ENSMUST00000209796
AA Change: G39E
Predicted Effect probably benign
Transcript: ENSMUST00000210027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211259
Predicted Effect probably benign
Transcript: ENSMUST00000211357
Predicted Effect probably benign
Transcript: ENSMUST00000211513
Meta Mutation Damage Score 0.1249 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (105/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA XI is likely a secreted protein, however, radical changes at active site residues completely conserved in CA isozymes with catalytic activity, make it unlikely that it has carbonic anhydrase activity. It shares properties in common with two other acatalytic CA isoforms, CA VIII and CA X. CA XI is most abundantly expressed in brain, and may play a general role in the central nervous system. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,406,453 I497V probably benign Het
2010300C02Rik T C 1: 37,625,300 M506V probably benign Het
4930571K23Rik C A 7: 125,369,139 noncoding transcript Het
Abca17 G T 17: 24,289,613 probably benign Het
Ablim1 C T 19: 57,152,359 R196Q probably damaging Het
Acot11 T C 4: 106,755,319 I379V possibly damaging Het
Acot4 G A 12: 84,041,873 G165D probably damaging Het
Agrn A T 4: 156,166,424 probably null Het
Ahctf1 T C 1: 179,770,693 S945G possibly damaging Het
Akr1c13 C T 13: 4,198,584 R263C probably damaging Het
Arfgap1 T A 2: 180,974,053 probably benign Het
Arhgef3 A G 14: 27,379,676 K103R probably damaging Het
Cabp1 A T 5: 115,172,784 N211K probably damaging Het
Cacna1c T A 6: 118,734,982 D261V probably damaging Het
Card10 A G 15: 78,780,273 I821T probably benign Het
Cast T C 13: 74,737,616 I277V probably benign Het
Cenpj T C 14: 56,532,237 K1165R probably null Het
Cenpk A G 13: 104,234,167 probably null Het
Cmya5 T C 13: 93,093,558 Q1674R probably benign Het
Cnnm1 T A 19: 43,441,886 V481D probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2c50 G A 19: 40,090,569 V119I probably benign Het
Dnah7b A G 1: 46,195,287 T1460A probably damaging Het
Dnah8 G A 17: 30,775,045 D3379N probably benign Het
Dnajc4 C T 19: 6,990,743 R55H probably damaging Het
Ebf4 C T 2: 130,306,562 R98* probably null Het
Epha4 G A 1: 77,511,702 A47V possibly damaging Het
Ercc8 T C 13: 108,183,717 probably benign Het
Exo1 T C 1: 175,905,833 F75S probably damaging Het
Fam168a G T 7: 100,834,184 probably null Het
Fat3 G A 9: 15,925,014 R4065W possibly damaging Het
Gm10639 T A 9: 78,294,807 M1K probably null Het
Gm13103 G A 4: 143,851,991 V274I probably benign Het
Gm5431 T A 11: 48,888,709 N740I probably benign Het
Gm5900 T A 7: 104,950,364 noncoding transcript Het
Gpi1 A G 7: 34,205,923 S359P probably damaging Het
Gpr156 A G 16: 37,947,787 R22G probably benign Het
Greb1 A G 12: 16,724,922 V158A probably damaging Het
Grin2c T A 11: 115,251,068 K842* probably null Het
Hnf4a T A 2: 163,566,241 L329Q probably damaging Het
Hsp90ab1 A G 17: 45,569,341 L92P probably damaging Het
Ido1 T A 8: 24,584,485 R290* probably null Het
Ifnlr1 G T 4: 135,705,248 D332Y probably damaging Het
Ift172 T C 5: 31,262,968 N1108S probably benign Het
Igkv3-9 T A 6: 70,588,744 M109K probably benign Het
Igsf10 T C 3: 59,331,866 D298G probably damaging Het
Iqck T G 7: 118,876,282 M98R probably benign Het
Klk1b1 T C 7: 43,969,379 V60A probably damaging Het
Krtap1-3 C T 11: 99,590,827 E165K unknown Het
Lair1 A G 7: 4,010,783 L155P probably damaging Het
Mast4 G T 13: 102,853,842 S57Y probably damaging Het
Mical3 T C 6: 121,034,157 H360R probably damaging Het
Muc5b A T 7: 141,859,061 N1915Y unknown Het
Myh1 A G 11: 67,205,597 I301V probably benign Het
Nck2 T A 1: 43,554,233 V200E probably damaging Het
Olfr10 T G 11: 49,318,221 L225R probably damaging Het
Olfr1214 T G 2: 88,987,431 Y257S probably damaging Het
Olfr1271 T C 2: 90,265,686 Y248C possibly damaging Het
Olfr1282 C T 2: 111,335,731 V116I probably damaging Het
Olfr1313 T A 2: 112,072,492 L30F probably benign Het
Olfr1453 T A 19: 13,027,694 I212F probably damaging Het
Olfr668 G A 7: 104,925,687 H26Y probably benign Het
Olfr870 A G 9: 20,171,229 L114P probably damaging Het
Otoa C T 7: 121,160,472 T1099I probably benign Het
Pask T A 1: 93,330,763 I288F possibly damaging Het
Pcnx4 T C 12: 72,566,972 W564R probably damaging Het
Pitpnm2 T C 5: 124,136,326 E240G probably damaging Het
Ppp1r16b A G 2: 158,761,463 Y436C possibly damaging Het
Prkca T C 11: 107,979,206 Y37C probably damaging Het
Rad18 T G 6: 112,675,922 H238P possibly damaging Het
Rap1b T A 10: 117,818,539 Q1L probably damaging Het
Rgs9 T C 11: 109,268,972 Y178C probably benign Het
Rpl3l A T 17: 24,732,386 D87V possibly damaging Het
Scrn2 T C 11: 97,033,166 V292A possibly damaging Het
Sdad1 A G 5: 92,305,825 Y35H probably benign Het
Sez6l2 T C 7: 126,953,772 S177P probably benign Het
Sh3bp1 C T 15: 78,911,506 P612S probably damaging Het
Shank1 T C 7: 44,351,724 S956P unknown Het
Shank1 G A 7: 44,352,123 A1089T unknown Het
Shprh G A 10: 11,166,724 C817Y probably damaging Het
Spata22 C T 11: 73,345,767 P300S probably damaging Het
Sstr2 A T 11: 113,624,923 I223F probably damaging Het
Stom C T 2: 35,320,342 A217T probably damaging Het
Stpg1 T C 4: 135,536,649 V341A probably benign Het
Tagap A G 17: 7,928,754 T99A probably benign Het
Tas1r2 A G 4: 139,659,851 N207S probably damaging Het
Thbs2 A G 17: 14,685,843 V265A probably benign Het
Thyn1 A G 9: 27,000,020 R3G possibly damaging Het
Tia1 T A 6: 86,424,330 probably null Het
Tktl2 A G 8: 66,512,852 E354G probably benign Het
Tmc8 A G 11: 117,792,685 T689A possibly damaging Het
Tmem11 A T 11: 60,864,981 probably null Het
Tmem55b A T 14: 50,929,658 Y129* probably null Het
Tmem57 A G 4: 134,804,388 S657P probably damaging Het
Tnik T C 3: 28,667,915 V1310A probably damaging Het
Trappc10 A G 10: 78,211,523 S380P possibly damaging Het
Trim8 C T 19: 46,515,295 P429S probably benign Het
Ttc25 T G 11: 100,553,535 L222R probably damaging Het
Ttn C A 2: 76,857,412 probably benign Het
Ulk2 T C 11: 61,787,514 Y793C probably benign Het
Vill G A 9: 119,070,302 V337M possibly damaging Het
Vps53 C A 11: 76,066,835 V364F possibly damaging Het
Wdr66 A G 5: 123,256,106 K353E probably benign Het
Zan A T 5: 137,456,586 I1396N unknown Het
Zfa-ps A C 10: 52,544,243 noncoding transcript Het
Zfp426 T C 9: 20,470,681 T337A possibly damaging Het
Zfp536 T C 7: 37,567,978 E671G possibly damaging Het
Zfp985 A G 4: 147,582,986 T104A possibly damaging Het
Other mutations in Car11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02195:Car11 APN 7 45701292 missense probably damaging 0.97
IGL03189:Car11 APN 7 45702455 missense probably damaging 0.98
R1201:Car11 UTSW 7 45703480 missense probably benign
R1625:Car11 UTSW 7 45701307 missense probably benign 0.04
R1670:Car11 UTSW 7 45703525 missense possibly damaging 0.52
R2430:Car11 UTSW 7 45703648 splice site probably null
R2510:Car11 UTSW 7 45701359 missense probably damaging 0.96
R2680:Car11 UTSW 7 45702485 missense probably benign
R3926:Car11 UTSW 7 45700491 missense probably benign 0.17
R5511:Car11 UTSW 7 45700461 missense probably damaging 1.00
R5639:Car11 UTSW 7 45702621 critical splice donor site probably null
R7395:Car11 UTSW 7 45701321 nonsense probably null
R7490:Car11 UTSW 7 45700318 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AATCCACACAGCAGGTCCTG -3'
(R):5'- CACTGAGACCATGTCACTTGG -3'

Sequencing Primer
(F):5'- TTTCTGTTCCCATAGGGC -3'
(R):5'- TGTGTGACCCCAGGCAAGTAAC -3'
Posted On2014-12-04