Incidental Mutation 'R2847:Erc2'
ID251759
Institutional Source Beutler Lab
Gene Symbol Erc2
Ensembl Gene ENSMUSG00000040640
Gene NameELKS/RAB6-interacting/CAST family member 2
SynonymsELKS2alpha, D14Ertd171e
MMRRC Submission 040440-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2847 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location27622428-28478537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28040488 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 736 (V736A)
Ref Sequence ENSEMBL: ENSMUSP00000147886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090302] [ENSMUST00000210135] [ENSMUST00000210924] [ENSMUST00000211145]
Predicted Effect probably damaging
Transcript: ENSMUST00000090302
AA Change: V736A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000087773
Gene: ENSMUSG00000040640
AA Change: V736A

DomainStartEndE-ValueType
low complexity region 14 45 N/A INTRINSIC
low complexity region 121 133 N/A INTRINSIC
Pfam:Cast 150 907 N/A PFAM
low complexity region 916 928 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000210135
AA Change: V756A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000210924
AA Change: V402A

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000211145
AA Change: V736A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Rab3-interacting molecule (RIM)-binding protein family. Members of this protein family form part of the cytomatrix at the active zone (CAZ) complex and function as regulators of neurotransmitter release. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for targeted disruptions of this gene are viable and fertile. However, homozygotes for one allele display abnormal CNS synaptic transmission. Homozygotes for a second allele display retinal abnormalities and impaired vision. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930510E17Rik T C 9: 53,264,789 noncoding transcript Het
Abca13 T C 11: 9,294,584 V2149A possibly damaging Het
Abca8a T C 11: 110,042,105 D1231G probably damaging Het
Adgrf5 C A 17: 43,422,640 N118K possibly damaging Het
Atxn1 A T 13: 45,566,699 D573E probably damaging Het
Bub3 C T 7: 131,570,884 T326M possibly damaging Het
Cd151 T C 7: 141,469,550 Y57H probably damaging Het
Cib4 T C 5: 30,488,588 N112S probably damaging Het
Cntnap5c A T 17: 57,876,392 D31V probably damaging Het
Cobl A G 11: 12,378,342 L81P probably damaging Het
Cpsf1 A T 15: 76,602,851 L209Q probably damaging Het
Crocc G A 4: 141,018,756 A1684V probably damaging Het
Cyp4f37 T A 17: 32,629,125 C206S probably damaging Het
Defb39 C T 8: 19,052,893 R62H possibly damaging Het
Diexf A T 1: 193,128,451 N81K probably benign Het
Dnah6 T C 6: 73,129,331 K1756E probably benign Het
Efcab12 A G 6: 115,811,111 I630T probably damaging Het
Fbf1 C T 11: 116,157,688 probably null Het
Fndc9 C T 11: 46,238,041 A129V probably damaging Het
Foxk2 CGGGGGG CGGGGGGGGG 11: 121,260,491 probably benign Het
Gba2 T C 4: 43,568,000 probably null Het
Gna12 T A 5: 140,785,593 D61V probably damaging Het
Gpr37 C T 6: 25,666,946 probably benign Het
Grin2a A G 16: 9,761,965 F145L possibly damaging Het
Grin2b C A 6: 135,740,953 V714L probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Hmcn1 G T 1: 150,563,599 Y5494* probably null Het
Htr4 T C 18: 62,428,126 S153P probably damaging Het
Igkv9-120 T A 6: 68,050,144 probably benign Het
Itgb6 T C 2: 60,600,535 T772A probably damaging Het
Mgam C A 6: 40,652,715 A86E possibly damaging Het
Mme T A 3: 63,345,199 N421K possibly damaging Het
Mmp1b C T 9: 7,370,763 V331I probably benign Het
Naa16 A G 14: 79,335,883 C816R probably damaging Het
Nav1 G C 1: 135,450,644 probably null Het
Nln A G 13: 104,025,025 M679T probably damaging Het
Olfr353 A G 2: 36,890,524 L108P probably damaging Het
Olfr920 C T 9: 38,756,036 T116I possibly damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Otop3 T C 11: 115,344,558 F339L probably damaging Het
Pax7 T C 4: 139,779,643 D361G possibly damaging Het
Peg10 C T 6: 4,756,912 probably benign Het
Plekhh2 G T 17: 84,597,966 R1096L probably damaging Het
Poteg A T 8: 27,481,676 N406I probably benign Het
Rnf43 T A 11: 87,732,267 N731K probably benign Het
Robo4 C T 9: 37,404,476 R342* probably null Het
Sec23ip G A 7: 128,754,073 V307I probably benign Het
Slc2a4 T A 11: 69,946,171 N116Y probably damaging Het
St5 T C 7: 109,525,337 Q1099R probably damaging Het
Tas1r3 T A 4: 155,860,202 Q854L probably benign Het
Tox3 G A 8: 90,248,390 Q538* probably null Het
Trpm4 A G 7: 45,310,598 F771S probably damaging Het
Tstd3 A T 4: 21,759,375 F132L possibly damaging Het
Ulk2 T C 11: 61,824,729 probably null Het
Unc13b T C 4: 43,180,404 Y3080H probably benign Het
Vmn1r181 G T 7: 23,984,518 S136I possibly damaging Het
Vmn2r114 A T 17: 23,290,974 M844K probably benign Het
Vmn2r60 A T 7: 42,136,433 H220L probably benign Het
Vps13a A G 19: 16,703,599 S1078P probably damaging Het
Vwa8 G T 14: 78,947,142 R360L probably benign Het
Xlr4b A T X: 73,215,332 Q25L probably null Het
Zdhhc22 T A 12: 86,988,562 T39S probably benign Het
Zfp532 T A 18: 65,656,626 H1045Q possibly damaging Het
Zfp773 AGCTGCTGCTGCTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTGC 7: 7,133,093 probably benign Het
Zfp964 G C 8: 69,663,854 C368S unknown Het
Zfp985 G A 4: 147,583,011 W112* probably null Het
Other mutations in Erc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Erc2 APN 14 28040521 missense probably damaging 0.98
IGL01862:Erc2 APN 14 28271569 splice site probably benign
IGL01906:Erc2 APN 14 28141306 missense probably damaging 0.99
IGL02177:Erc2 APN 14 27898623 missense probably benign 0.00
IGL02481:Erc2 APN 14 27653071 missense probably damaging 1.00
IGL02483:Erc2 APN 14 27653071 missense probably damaging 1.00
IGL02623:Erc2 APN 14 27776980 missense probably damaging 1.00
IGL03252:Erc2 APN 14 28475649 utr 3 prime probably benign
IGL03378:Erc2 APN 14 28011723 missense probably damaging 1.00
lobe UTSW 14 28317251 missense probably damaging 0.96
R0091:Erc2 UTSW 14 27776824 critical splice acceptor site probably null
R0309:Erc2 UTSW 14 28141225 missense probably damaging 0.98
R0357:Erc2 UTSW 14 27777022 missense probably damaging 0.99
R0378:Erc2 UTSW 14 28011694 missense probably damaging 1.00
R0550:Erc2 UTSW 14 28271651 missense possibly damaging 0.74
R0815:Erc2 UTSW 14 28025148 missense probably benign 0.04
R0863:Erc2 UTSW 14 28025148 missense probably benign 0.04
R1121:Erc2 UTSW 14 28475655 utr 3 prime probably benign
R1164:Erc2 UTSW 14 28302972 missense probably damaging 0.99
R1498:Erc2 UTSW 14 28302898 missense probably benign 0.27
R1500:Erc2 UTSW 14 28271660 missense probably damaging 0.98
R1555:Erc2 UTSW 14 28011665 missense probably damaging 0.99
R1894:Erc2 UTSW 14 28141228 missense probably damaging 0.99
R1950:Erc2 UTSW 14 27912900 missense probably damaging 0.99
R1991:Erc2 UTSW 14 28011636 missense probably benign 0.34
R2698:Erc2 UTSW 14 28271705 missense probably benign 0.06
R3015:Erc2 UTSW 14 28011775 critical splice donor site probably null
R3612:Erc2 UTSW 14 27777177 missense possibly damaging 0.69
R3759:Erc2 UTSW 14 28025163 missense possibly damaging 0.94
R3857:Erc2 UTSW 14 28475642 utr 3 prime probably benign
R3858:Erc2 UTSW 14 28475642 utr 3 prime probably benign
R3859:Erc2 UTSW 14 28475642 utr 3 prime probably benign
R4556:Erc2 UTSW 14 28302904 missense probably damaging 1.00
R4739:Erc2 UTSW 14 27776881 missense probably damaging 1.00
R4898:Erc2 UTSW 14 27653328 missense probably damaging 1.00
R5068:Erc2 UTSW 14 28302943 missense possibly damaging 0.63
R5113:Erc2 UTSW 14 27652872 missense probably benign 0.40
R5418:Erc2 UTSW 14 27966510 missense probably benign 0.14
R5741:Erc2 UTSW 14 28302869 splice site probably null
R5819:Erc2 UTSW 14 28141369 missense probably damaging 0.97
R5930:Erc2 UTSW 14 27776858 missense probably damaging 0.99
R6073:Erc2 UTSW 14 28011636 missense probably benign 0.00
R6150:Erc2 UTSW 14 28141291 missense probably damaging 0.97
R6182:Erc2 UTSW 14 28317253 missense probably damaging 0.99
R6188:Erc2 UTSW 14 28317251 missense probably damaging 0.96
R6267:Erc2 UTSW 14 28080155 missense probably damaging 1.00
R6296:Erc2 UTSW 14 28080155 missense probably damaging 1.00
R6730:Erc2 UTSW 14 27898567 missense possibly damaging 0.95
R6969:Erc2 UTSW 14 27898596 missense probably damaging 1.00
R7095:Erc2 UTSW 14 27898593 missense probably damaging 0.99
R7221:Erc2 UTSW 14 27653158 missense probably damaging 0.97
R7365:Erc2 UTSW 14 28040389 missense probably damaging 1.00
R7454:Erc2 UTSW 14 28302991 missense possibly damaging 0.92
R7763:Erc2 UTSW 14 27876204 critical splice donor site probably null
R7784:Erc2 UTSW 14 27898594 missense probably damaging 0.96
R7890:Erc2 UTSW 14 28040341 critical splice acceptor site probably null
R7894:Erc2 UTSW 14 27777208 missense probably damaging 1.00
R8031:Erc2 UTSW 14 28011692 missense probably damaging 0.99
R8206:Erc2 UTSW 14 28303015 splice site probably null
R8273:Erc2 UTSW 14 27777139 missense probably benign 0.41
R8304:Erc2 UTSW 14 27653165 missense probably damaging 0.99
R8387:Erc2 UTSW 14 27653296 missense possibly damaging 0.92
R8751:Erc2 UTSW 14 28080188 missense possibly damaging 0.78
R8851:Erc2 UTSW 14 28317259 missense probably null 0.99
Predicted Primers PCR Primer
(F):5'- CGACACTGTCTATTGTTCTGAACC -3'
(R):5'- TTGCTGGAAGGCTACAGTCC -3'

Sequencing Primer
(F):5'- TGTTCTGAACCATTGTCTTAACTAC -3'
(R):5'- TGGAAGGCTACAGTCCTCATG -3'
Posted On2014-12-04