Mutagenetix > Incidental Mutations

Incidental Mutation 'R2847:Cpsf1'

251765

Institutional Source

Beutler Lab

Gene Symbol

Cpsf1

Ensembl Gene

ENSMUSG00000034022

Gene Name

cleavage and polyadenylation specific factor 1

Synonyms

MMRRC Submission

040440-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.967) question?

Stock #

R2847 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

76595803-76607591 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 76602851 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 209 (L209Q)

Ref Sequence

ENSEMBL: ENSMUSP00000155308 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071898] [ENSMUST00000230157] [ENSMUST00000231042]

Predicted Effect

probably damaging
Transcript: ENSMUST00000071898
AA Change: L209Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000071794
Gene: ENSMUSG00000034022
AA Change: L209Q

Domain	Start	End	E-Value	Type
Pfam:MMS1_N	92	684	7.2e-42	PFAM
low complexity region	902	910	N/A	INTRINSIC
Pfam:CPSF_A	1071	1407	4.9e-94	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229015

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229269

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229367

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229437

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229447

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229504

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229797

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229798

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229982

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230149

Predicted Effect

probably damaging
Transcript: ENSMUST00000230157
AA Change: L209Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230557

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230903

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231037

Predicted Effect

probably benign
Transcript: ENSMUST00000231042

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231191

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cleavage and polyadenylation specificity factor (CPSF) is a multisubunit complex that plays a central role in 3-prime processing of pre-mRNAs. CPSF recognizes the AAUAAA signal in the pre-mRNA and interacts with other proteins to facilitate both RNA cleavage and poly(A) synthesis. CPSF1 is the largest subunit of the CPSF complex (Murthy and Manley, 1995 [PubMed 7590244]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930510E17Rik	T	C	9: 53,264,789		noncoding transcript	Het
Abca13	T	C	11: 9,294,584	V2149A	possibly damaging	Het
Abca8a	T	C	11: 110,042,105	D1231G	probably damaging	Het
Adgrf5	C	A	17: 43,422,640	N118K	possibly damaging	Het
Atxn1	A	T	13: 45,566,699	D573E	probably damaging	Het
Bub3	C	T	7: 131,570,884	T326M	possibly damaging	Het
Cd151	T	C	7: 141,469,550	Y57H	probably damaging	Het
Cib4	T	C	5: 30,488,588	N112S	probably damaging	Het
Cntnap5c	A	T	17: 57,876,392	D31V	probably damaging	Het
Cobl	A	G	11: 12,378,342	L81P	probably damaging	Het
Crocc	G	A	4: 141,018,756	A1684V	probably damaging	Het
Cyp4f37	T	A	17: 32,629,125	C206S	probably damaging	Het
Defb39	C	T	8: 19,052,893	R62H	possibly damaging	Het
Diexf	A	T	1: 193,128,451	N81K	probably benign	Het
Dnah6	T	C	6: 73,129,331	K1756E	probably benign	Het
Efcab12	A	G	6: 115,811,111	I630T	probably damaging	Het
Erc2	T	C	14: 28,040,488	V736A	probably damaging	Het
Fbf1	C	T	11: 116,157,688		probably null	Het
Fndc9	C	T	11: 46,238,041	A129V	probably damaging	Het
Foxk2	CGGGGGG	CGGGGGGGGG	11: 121,260,491		probably benign	Het
Gba2	T	C	4: 43,568,000		probably null	Het
Gna12	T	A	5: 140,785,593	D61V	probably damaging	Het
Gpr37	C	T	6: 25,666,946		probably benign	Het
Grin2a	A	G	16: 9,761,965	F145L	possibly damaging	Het
Grin2b	C	A	6: 135,740,953	V714L	probably damaging	Het
Grm7	G	T	6: 110,646,348	V161F	probably damaging	Het
Hmcn1	G	T	1: 150,563,599	Y5494*	probably null	Het
Htr4	T	C	18: 62,428,126	S153P	probably damaging	Het
Igkv9-120	T	A	6: 68,050,144		probably benign	Het
Itgb6	T	C	2: 60,600,535	T772A	probably damaging	Het
Mgam	C	A	6: 40,652,715	A86E	possibly damaging	Het
Mme	T	A	3: 63,345,199	N421K	possibly damaging	Het
Mmp1b	C	T	9: 7,370,763	V331I	probably benign	Het
Naa16	A	G	14: 79,335,883	C816R	probably damaging	Het
Nav1	G	C	1: 135,450,644		probably null	Het
Nln	A	G	13: 104,025,025	M679T	probably damaging	Het
Olfr353	A	G	2: 36,890,524	L108P	probably damaging	Het
Olfr920	C	T	9: 38,756,036	T116I	possibly damaging	Het
Osbpl8	T	A	10: 111,269,436	S251T	probably benign	Het
Otop3	T	C	11: 115,344,558	F339L	probably damaging	Het
Pax7	T	C	4: 139,779,643	D361G	possibly damaging	Het
Peg10	C	T	6: 4,756,912		probably benign	Het
Plekhh2	G	T	17: 84,597,966	R1096L	probably damaging	Het
Poteg	A	T	8: 27,481,676	N406I	probably benign	Het
Rnf43	T	A	11: 87,732,267	N731K	probably benign	Het
Robo4	C	T	9: 37,404,476	R342*	probably null	Het
Sec23ip	G	A	7: 128,754,073	V307I	probably benign	Het
Slc2a4	T	A	11: 69,946,171	N116Y	probably damaging	Het
St5	T	C	7: 109,525,337	Q1099R	probably damaging	Het
Tas1r3	T	A	4: 155,860,202	Q854L	probably benign	Het
Tox3	G	A	8: 90,248,390	Q538*	probably null	Het
Trpm4	A	G	7: 45,310,598	F771S	probably damaging	Het
Tstd3	A	T	4: 21,759,375	F132L	possibly damaging	Het
Ulk2	T	C	11: 61,824,729		probably null	Het
Unc13b	T	C	4: 43,180,404	Y3080H	probably benign	Het
Vmn1r181	G	T	7: 23,984,518	S136I	possibly damaging	Het
Vmn2r114	A	T	17: 23,290,974	M844K	probably benign	Het
Vmn2r60	A	T	7: 42,136,433	H220L	probably benign	Het
Vps13a	A	G	19: 16,703,599	S1078P	probably damaging	Het
Vwa8	G	T	14: 78,947,142	R360L	probably benign	Het
Xlr4b	A	T	X: 73,215,332	Q25L	probably null	Het
Zdhhc22	T	A	12: 86,988,562	T39S	probably benign	Het
Zfp532	T	A	18: 65,656,626	H1045Q	possibly damaging	Het
Zfp773	AGCTGCTGCTGCTGCTGCTGCTGCTGC	AGCTGCTGCTGCTGCTGCTGCTGC	7: 7,133,093		probably benign	Het
Zfp964	G	C	8: 69,663,854	C368S	unknown	Het
Zfp985	G	A	4: 147,583,011	W112*	probably null	Het

Other mutations in Cpsf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Cpsf1	APN	15	76600216	missense	probably benign	0.27
IGL01013:Cpsf1	APN	15	76599297	nonsense	probably null
IGL01599:Cpsf1	APN	15	76596541	missense	probably damaging	1.00
IGL02008:Cpsf1	APN	15	76603091	missense	probably damaging	1.00
IGL02291:Cpsf1	APN	15	76602821	missense	probably damaging	1.00
IGL02901:Cpsf1	APN	15	76599496	nonsense	probably null
IGL02929:Cpsf1	APN	15	76602127	critical splice donor site	probably null
IGL03402:Cpsf1	APN	15	76596003	splice site	probably null
R0005:Cpsf1	UTSW	15	76600680	critical splice donor site	probably null
R0044:Cpsf1	UTSW	15	76599553	missense	probably benign
R0044:Cpsf1	UTSW	15	76599553	missense	probably benign
R0487:Cpsf1	UTSW	15	76597002	missense	probably damaging	1.00
R0510:Cpsf1	UTSW	15	76603657	intron	probably benign
R0630:Cpsf1	UTSW	15	76601971	missense	probably damaging	1.00
R0780:Cpsf1	UTSW	15	76600377	missense	probably benign	0.17
R1617:Cpsf1	UTSW	15	76602370	nonsense	probably null
R1717:Cpsf1	UTSW	15	76602566	missense	possibly damaging	0.77
R1889:Cpsf1	UTSW	15	76602156	missense	probably benign	0.06
R1994:Cpsf1	UTSW	15	76603160	missense	probably benign	0.03
R2168:Cpsf1	UTSW	15	76603737	missense	possibly damaging	0.69
R2359:Cpsf1	UTSW	15	76597673	missense	probably benign	0.02
R2697:Cpsf1	UTSW	15	76599329	missense	probably damaging	1.00
R2848:Cpsf1	UTSW	15	76602851	missense	probably damaging	1.00
R3409:Cpsf1	UTSW	15	76601781	nonsense	probably null
R3410:Cpsf1	UTSW	15	76601781	nonsense	probably null
R3815:Cpsf1	UTSW	15	76601149	missense	probably benign	0.22
R4030:Cpsf1	UTSW	15	76601779	missense	possibly damaging	0.96
R4491:Cpsf1	UTSW	15	76597722	missense	possibly damaging	0.85
R4615:Cpsf1	UTSW	15	76596937	missense	possibly damaging	0.88
R5227:Cpsf1	UTSW	15	76598948	missense	probably damaging	1.00
R5353:Cpsf1	UTSW	15	76602571	missense	probably damaging	1.00
R5548:Cpsf1	UTSW	15	76597327	missense	possibly damaging	0.95
R5552:Cpsf1	UTSW	15	76599646	missense	probably benign	0.27
R5746:Cpsf1	UTSW	15	76599837	missense	probably benign	0.01
R6319:Cpsf1	UTSW	15	76596967	missense	probably damaging	1.00
R6360:Cpsf1	UTSW	15	76597455	frame shift	probably null
R6572:Cpsf1	UTSW	15	76597455	frame shift	probably null
R6574:Cpsf1	UTSW	15	76597455	frame shift	probably null
R6576:Cpsf1	UTSW	15	76597455	frame shift	probably null
R6577:Cpsf1	UTSW	15	76597455	frame shift	probably null
R6588:Cpsf1	UTSW	15	76596822	missense	probably damaging	1.00
R6595:Cpsf1	UTSW	15	76602510	missense	probably damaging	1.00
R6621:Cpsf1	UTSW	15	76603519	missense	probably damaging	1.00
R6880:Cpsf1	UTSW	15	76602539	missense	probably benign	0.06
R6954:Cpsf1	UTSW	15	76599496	missense	probably damaging	1.00
R7100:Cpsf1	UTSW	15	76596114	missense	possibly damaging	0.73
R7255:Cpsf1	UTSW	15	76597543	missense	probably damaging	1.00
R7318:Cpsf1	UTSW	15	76597275	nonsense	probably null
R7371:Cpsf1	UTSW	15	76600575	missense	probably damaging	1.00
R7387:Cpsf1	UTSW	15	76602566	missense	possibly damaging	0.77
R7446:Cpsf1	UTSW	15	76601750	missense	probably benign
R7612:Cpsf1	UTSW	15	76597009	missense	probably benign	0.00
R7739:Cpsf1	UTSW	15	76600311	missense	probably benign	0.00
X0052:Cpsf1	UTSW	15	76596302	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- ACAATGGAGCACGTGTCCTG -3'
(R):5'- CGAAGGGTGAGTACTAAGCC -3'

Sequencing Primer
(F):5'- CCAGAGGCAGTCACATTGCTC -3'
(R):5'- TGAGTACTAAGCCGAGCTGG -3'

Posted On

2014-12-04