Mutagenetix > Incidental Mutation

Incidental Mutation 'R0311:Adgrb2'

25177

Institutional Source

Beutler Lab

Gene Symbol

Adgrb2

Ensembl Gene

ENSMUSG00000028782

Gene Name

adhesion G protein-coupled receptor B2

Synonyms

Bai2

MMRRC Submission

038521-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0311 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

129984870-130022633 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 130017129 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Proline at position 1168 (A1168P)

Ref Sequence

ENSEMBL: ENSMUSP00000101636 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030571] [ENSMUST00000097868] [ENSMUST00000106015] [ENSMUST00000106017] [ENSMUST00000106018] [ENSMUST00000120204] [ENSMUST00000121049]

AlphaFold

Q8CGM1

Predicted Effect

probably damaging
Transcript: ENSMUST00000030571
AA Change: A1168P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030571
Gene: ENSMUSG00000028782
AA Change: A1168P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	117	127	N/A	INTRINSIC
low complexity region	160	173	N/A	INTRINSIC
low complexity region	197	208	N/A	INTRINSIC
low complexity region	272	278	N/A	INTRINSIC
TSP1	303	353	9.52e-11	SMART
TSP1	358	408	1.86e-13	SMART
TSP1	413	463	9.89e-9	SMART
TSP1	469	519	3.09e-10	SMART
HormR	521	587	3.27e-18	SMART
Pfam:GAIN	600	842	1.6e-41	PFAM
GPS	864	917	2.57e-19	SMART
Pfam:7tm_2	923	1192	1.7e-67	PFAM
low complexity region	1357	1371	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000097868
AA Change: A1135P

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000095480
Gene: ENSMUSG00000028782
AA Change: A1135P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	117	127	N/A	INTRINSIC
low complexity region	160	173	N/A	INTRINSIC
low complexity region	197	208	N/A	INTRINSIC
low complexity region	272	278	N/A	INTRINSIC
TSP1	303	353	9.52e-11	SMART
TSP1	358	408	1.86e-13	SMART
TSP1	413	463	9.89e-9	SMART
TSP1	469	519	3.09e-10	SMART
HormR	521	587	3.27e-18	SMART
Pfam:DUF3497	597	859	1.2e-54	PFAM
GPS	864	917	2.57e-19	SMART
Pfam:7tm_2	923	1159	2.6e-69	PFAM
low complexity region	1324	1338	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000106012

Predicted Effect

probably damaging
Transcript: ENSMUST00000106015
AA Change: A1168P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101636
Gene: ENSMUSG00000028782
AA Change: A1168P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	117	127	N/A	INTRINSIC
low complexity region	160	173	N/A	INTRINSIC
low complexity region	197	208	N/A	INTRINSIC
low complexity region	272	278	N/A	INTRINSIC
TSP1	303	353	9.52e-11	SMART
TSP1	358	408	1.86e-13	SMART
TSP1	413	463	9.89e-9	SMART
TSP1	469	519	3.09e-10	SMART
HormR	521	587	3.27e-18	SMART
Pfam:DUF3497	597	859	6.4e-55	PFAM
GPS	864	917	2.57e-19	SMART
Pfam:7tm_2	923	1192	4.1e-68	PFAM
low complexity region	1357	1371	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106017
AA Change: A1156P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000101638
Gene: ENSMUSG00000028782
AA Change: A1156P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	117	127	N/A	INTRINSIC
low complexity region	160	173	N/A	INTRINSIC
low complexity region	197	208	N/A	INTRINSIC
low complexity region	272	278	N/A	INTRINSIC
TSP1	303	353	9.52e-11	SMART
TSP1	358	408	1.86e-13	SMART
TSP1	413	463	9.89e-9	SMART
TSP1	469	519	3.09e-10	SMART
HormR	521	587	3.27e-18	SMART
Pfam:DUF3497	597	859	6.3e-55	PFAM
GPS	864	917	2.57e-19	SMART
Pfam:7tm_2	923	1180	4.6e-68	PFAM
low complexity region	1345	1359	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106018
AA Change: A1080P

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000101639
Gene: ENSMUSG00000028782
AA Change: A1080P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	117	127	N/A	INTRINSIC
low complexity region	160	173	N/A	INTRINSIC
low complexity region	197	208	N/A	INTRINSIC
low complexity region	272	278	N/A	INTRINSIC
TSP1	303	353	1.86e-13	SMART
TSP1	358	408	9.89e-9	SMART
TSP1	414	464	3.09e-10	SMART
HormR	466	532	3.27e-18	SMART
Pfam:DUF3497	542	804	1.1e-54	PFAM
GPS	809	862	2.57e-19	SMART
Pfam:7tm_2	868	1104	2.4e-69	PFAM
low complexity region	1269	1283	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000120204
AA Change: A1080P

PolyPhen 2 Score 0.576 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000112524
Gene: ENSMUSG00000028782
AA Change: A1080P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	117	127	N/A	INTRINSIC
low complexity region	160	173	N/A	INTRINSIC
low complexity region	197	208	N/A	INTRINSIC
low complexity region	272	278	N/A	INTRINSIC
TSP1	303	353	9.52e-11	SMART
TSP1	358	408	9.89e-9	SMART
TSP1	414	464	3.09e-10	SMART
HormR	466	532	3.27e-18	SMART
Pfam:DUF3497	542	804	8.2e-55	PFAM
GPS	809	862	2.57e-19	SMART
Pfam:7tm_2	868	1104	9.6e-70	PFAM
low complexity region	1269	1283	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000121049
AA Change: A1113P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000112869
Gene: ENSMUSG00000028782
AA Change: A1113P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	117	127	N/A	INTRINSIC
low complexity region	160	173	N/A	INTRINSIC
low complexity region	197	208	N/A	INTRINSIC
low complexity region	272	278	N/A	INTRINSIC
TSP1	303	353	1.86e-13	SMART
TSP1	358	408	9.89e-9	SMART
TSP1	414	464	3.09e-10	SMART
HormR	466	532	3.27e-18	SMART
Pfam:DUF3497	542	804	6.1e-55	PFAM
GPS	809	862	2.57e-19	SMART
Pfam:7tm_2	868	1137	3.8e-68	PFAM
low complexity region	1302	1316	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136416

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136787

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163625

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166118

Meta Mutation Damage Score

0.7796

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.6%
20x: 91.6%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a a seven-span transmembrane protein that is thought to be a member of the secretin receptor family. The encoded protein is a brain-specific inhibitor of angiogenesis. The mature peptide may be further cleaved into additional products (PMID:20367554). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene show a lessening of depression like behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	A	C	7: 120,402,904	M1547L	probably damaging	Het
Abcb4	A	G	5: 8,934,243	K658E	probably benign	Het
Abr	A	G	11: 76,509,127	S15P	possibly damaging	Het
Adgre4	A	T	17: 55,802,010	E339V	probably benign	Het
Asprv1	T	C	6: 86,628,840	W223R	probably damaging	Het
Ccdc89	A	G	7: 90,426,693	E37G	probably damaging	Het
Cd48	C	A	1: 171,699,580	Y191*	probably null	Het
Chd4	T	C	6: 125,101,665	I257T	probably benign	Het
Clca4b	T	C	3: 144,932,496	M2V	probably benign	Het
Dnah11	A	T	12: 118,127,133	D1025E	probably benign	Het
Erich5	A	G	15: 34,472,939	*363W	probably null	Het
Etl4	A	G	2: 20,807,129	D1341G	probably damaging	Het
Fbxw11	A	G	11: 32,722,083	T184A	probably benign	Het
Fktn	A	G	4: 53,744,620	Q300R	probably benign	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gdpd3	G	A	7: 126,767,189	R66Q	possibly damaging	Het
Hexb	A	G	13: 97,183,819		probably benign	Het
Kdm4b	A	G	17: 56,386,200	R346G	probably benign	Het
Mbtd1	T	A	11: 93,921,357		probably null	Het
Med23	T	A	10: 24,897,358	C653S	possibly damaging	Het
Nwd2	A	T	5: 63,804,998	I642L	probably damaging	Het
Olfr1444	A	G	19: 12,861,869	I31M	probably benign	Het
Olfr1448	T	A	19: 12,920,096	Y71F	possibly damaging	Het
Olfr912	T	C	9: 38,539,297	V134A	probably benign	Het
Pbld2	T	C	10: 63,054,507		probably null	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Pkd1l3	G	A	8: 109,623,663	S380N	probably benign	Het
Plpp2	C	T	10: 79,527,580	R77K	probably damaging	Het
Pym1	G	T	10: 128,765,984	R168L	possibly damaging	Het
Rbm4	T	C	19: 4,787,556	Y300C	probably damaging	Het
Rnf207	A	G	4: 152,315,779	C175R	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Speg	T	C	1: 75,430,937	V3196A	probably damaging	Het
Syne1	T	A	10: 5,348,943	I1048L	possibly damaging	Het
Th	T	C	7: 142,896,041	E41G	probably damaging	Het
Tmx4	T	A	2: 134,598,526	*336L	probably null	Het
Tnfrsf18	T	C	4: 156,026,415	V10A	possibly damaging	Het
Tnxb	A	T	17: 34,716,984	I2670F	probably damaging	Het
Tpx2	T	C	2: 152,890,492	V562A	probably damaging	Het
Vmn2r73	A	G	7: 85,871,789	S324P	probably benign	Het
Vps18	T	C	2: 119,297,365	Y890H	probably benign	Het
Ythdc1	G	A	5: 86,835,705	D670N	probably damaging	Het

Other mutations in Adgrb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00309:Adgrb2	APN	4	130018805	missense	probably damaging	1.00
IGL00425:Adgrb2	APN	4	130019072	missense	probably benign	0.09
IGL00490:Adgrb2	APN	4	130011872	missense	possibly damaging	0.82
IGL00928:Adgrb2	APN	4	129992303	missense	probably benign
IGL01353:Adgrb2	APN	4	130012300	missense	probably damaging	1.00
IGL01521:Adgrb2	APN	4	129992292	missense	probably damaging	0.98
IGL01590:Adgrb2	APN	4	130013813	splice site	probably benign
IGL01813:Adgrb2	APN	4	130012566	missense	probably benign	0.00
IGL01831:Adgrb2	APN	4	130009394	missense	probably damaging	1.00
IGL01939:Adgrb2	APN	4	129992132	missense	probably damaging	0.99
IGL01960:Adgrb2	APN	4	130012384	splice site	probably benign
IGL01993:Adgrb2	APN	4	130018842	missense	possibly damaging	0.94
IGL02646:Adgrb2	APN	4	130019282	critical splice donor site	probably null
IGL02655:Adgrb2	APN	4	129992179	nonsense	probably null
IGL02695:Adgrb2	APN	4	130018832	missense	probably damaging	1.00
IGL02998:Adgrb2	APN	4	130019069	missense	probably benign	0.15
IGL03372:Adgrb2	APN	4	130017569	missense	probably benign	0.42
R0098:Adgrb2	UTSW	4	130007831	missense	probably damaging	0.99
R0206:Adgrb2	UTSW	4	129992559	missense	probably damaging	1.00
R0380:Adgrb2	UTSW	4	130007831	missense	probably damaging	0.99
R0382:Adgrb2	UTSW	4	130007831	missense	probably damaging	0.99
R0492:Adgrb2	UTSW	4	130007831	missense	probably damaging	0.99
R0544:Adgrb2	UTSW	4	130017542	missense	probably damaging	0.98
R0965:Adgrb2	UTSW	4	129992416	small deletion	probably benign
R1458:Adgrb2	UTSW	4	130014591	missense	possibly damaging	0.48
R1601:Adgrb2	UTSW	4	129992837	missense	probably benign	0.43
R1711:Adgrb2	UTSW	4	129992624	missense	probably damaging	1.00
R1758:Adgrb2	UTSW	4	130011875	missense	probably damaging	1.00
R1783:Adgrb2	UTSW	4	130009305	missense	possibly damaging	0.61
R1827:Adgrb2	UTSW	4	130012557	missense	probably damaging	1.00
R1838:Adgrb2	UTSW	4	130010231	missense	probably benign	0.00
R1881:Adgrb2	UTSW	4	130010285	missense	probably damaging	1.00
R1888:Adgrb2	UTSW	4	130013626	missense	probably damaging	1.00
R1888:Adgrb2	UTSW	4	130013626	missense	probably damaging	1.00
R1894:Adgrb2	UTSW	4	130013626	missense	probably damaging	1.00
R2275:Adgrb2	UTSW	4	130006854	missense	probably damaging	1.00
R2926:Adgrb2	UTSW	4	130008344	missense	probably damaging	1.00
R4472:Adgrb2	UTSW	4	130008353	missense	probably benign	0.12
R4490:Adgrb2	UTSW	4	130012328	missense	possibly damaging	0.91
R4499:Adgrb2	UTSW	4	129992661	missense	probably damaging	0.99
R4758:Adgrb2	UTSW	4	130009350	missense	probably damaging	1.00
R4900:Adgrb2	UTSW	4	130013875	missense	probably damaging	1.00
R4904:Adgrb2	UTSW	4	130012539	missense	possibly damaging	0.50
R4922:Adgrb2	UTSW	4	130007852	missense	probably damaging	1.00
R5330:Adgrb2	UTSW	4	130022202	missense	possibly damaging	0.92
R5331:Adgrb2	UTSW	4	130022202	missense	possibly damaging	0.92
R5550:Adgrb2	UTSW	4	130014934	critical splice acceptor site	probably null
R5995:Adgrb2	UTSW	4	130017103	missense	probably damaging	1.00
R6047:Adgrb2	UTSW	4	130018705	missense	probably damaging	1.00
R6534:Adgrb2	UTSW	4	130022219	missense	probably damaging	0.98
R6565:Adgrb2	UTSW	4	130019276	missense	probably damaging	1.00
R6813:Adgrb2	UTSW	4	130009491	missense	probably damaging	1.00
R6963:Adgrb2	UTSW	4	130014362	frame shift	probably null
R6966:Adgrb2	UTSW	4	130014362	frame shift	probably null
R7197:Adgrb2	UTSW	4	130009522	missense	probably damaging	1.00
R7409:Adgrb2	UTSW	4	130019069	missense	probably benign	0.15
R7451:Adgrb2	UTSW	4	130014557	missense	probably damaging	1.00
R7453:Adgrb2	UTSW	4	130014637	critical splice donor site	probably null
R7461:Adgrb2	UTSW	4	130021213	critical splice acceptor site	probably benign
R7511:Adgrb2	UTSW	4	130022111	missense	probably benign
R7613:Adgrb2	UTSW	4	130021213	critical splice acceptor site	probably benign
R7729:Adgrb2	UTSW	4	129992124	missense	probably benign	0.09
R7818:Adgrb2	UTSW	4	130014560	missense	probably damaging	0.98
R7818:Adgrb2	UTSW	4	130014969	missense	possibly damaging	0.70
R8033:Adgrb2	UTSW	4	130019012	missense	probably benign
R8039:Adgrb2	UTSW	4	130022268	missense	probably damaging	0.99
R8097:Adgrb2	UTSW	4	130007897	missense	probably damaging	1.00
R8256:Adgrb2	UTSW	4	130008128	missense	probably damaging	0.96
R8425:Adgrb2	UTSW	4	130005057	missense	possibly damaging	0.72
R8804:Adgrb2	UTSW	4	130005419	missense	probably damaging	1.00
R9011:Adgrb2	UTSW	4	130022318	missense	probably damaging	1.00
R9018:Adgrb2	UTSW	4	130013866	missense	probably benign	0.34
R9102:Adgrb2	UTSW	4	130019009	missense	probably benign	0.04
R9113:Adgrb2	UTSW	4	130017084	missense	probably damaging	1.00
R9120:Adgrb2	UTSW	4	130012509	missense	possibly damaging	0.52
R9211:Adgrb2	UTSW	4	129992406	missense	probably benign	0.07
R9267:Adgrb2	UTSW	4	129992108	missense	possibly damaging	0.93
R9328:Adgrb2	UTSW	4	130021570	missense	probably damaging	1.00
R9470:Adgrb2	UTSW	4	130009281	missense	probably damaging	1.00
R9608:Adgrb2	UTSW	4	130013559	missense	probably damaging	0.98
RF020:Adgrb2	UTSW	4	130010084	missense	probably damaging	1.00
Z1176:Adgrb2	UTSW	4	130017563	missense	probably damaging	1.00
Z1177:Adgrb2	UTSW	4	130011826	missense	probably damaging	0.99
Z1177:Adgrb2	UTSW	4	130019119	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGTCACATCTGTGCCTGCTGAGTC -3'
(R):5'- ATCTGAGCTATAAGCGCCCTCACC -3'

Sequencing Primer
(F):5'- TTGGAAACACTCCTGAGGTC -3'
(R):5'- CCTGTACCACACAGTGGAG -3'

Posted On

2013-04-16