Mutagenetix > Incidental Mutation

Incidental Mutation 'R2847:Plekhh2'

251777

Institutional Source

Beutler Lab

Gene Symbol

Plekhh2

Ensembl Gene

ENSMUSG00000040852

Gene Name

pleckstrin homology domain containing, family H (with MyTH4 domain) member 2

Synonyms

MMRRC Submission

040440-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.114) question?

Stock #

R2847 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

84511895-84622142 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 84597966 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 1096 (R1096L)

Ref Sequence

ENSEMBL: ENSMUSP00000039628 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047206]

AlphaFold

Q8C115

Predicted Effect

probably damaging
Transcript: ENSMUST00000047206
AA Change: R1096L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000039628
Gene: ENSMUSG00000040852
AA Change: R1096L

Domain	Start	End	E-Value	Type
coiled coil region	19	84	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
coiled coil region	137	174	N/A	INTRINSIC
low complexity region	427	442	N/A	INTRINSIC
low complexity region	579	593	N/A	INTRINSIC
low complexity region	612	651	N/A	INTRINSIC
low complexity region	657	666	N/A	INTRINSIC
PH	703	798	4.7e-19	SMART
PH	811	920	1.15e-4	SMART
MyTH4	954	1109	8.49e-39	SMART
B41	1116	1353	1.01e-27	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930510E17Rik	T	C	9: 53,264,789		noncoding transcript	Het
Abca13	T	C	11: 9,294,584	V2149A	possibly damaging	Het
Abca8a	T	C	11: 110,042,105	D1231G	probably damaging	Het
Adgrf5	C	A	17: 43,422,640	N118K	possibly damaging	Het
Atxn1	A	T	13: 45,566,699	D573E	probably damaging	Het
Bub3	C	T	7: 131,570,884	T326M	possibly damaging	Het
Cd151	T	C	7: 141,469,550	Y57H	probably damaging	Het
Cib4	T	C	5: 30,488,588	N112S	probably damaging	Het
Cntnap5c	A	T	17: 57,876,392	D31V	probably damaging	Het
Cobl	A	G	11: 12,378,342	L81P	probably damaging	Het
Cpsf1	A	T	15: 76,602,851	L209Q	probably damaging	Het
Crocc	G	A	4: 141,018,756	A1684V	probably damaging	Het
Cyp4f37	T	A	17: 32,629,125	C206S	probably damaging	Het
Defb39	C	T	8: 19,052,893	R62H	possibly damaging	Het
Diexf	A	T	1: 193,128,451	N81K	probably benign	Het
Dnah6	T	C	6: 73,129,331	K1756E	probably benign	Het
Efcab12	A	G	6: 115,811,111	I630T	probably damaging	Het
Erc2	T	C	14: 28,040,488	V736A	probably damaging	Het
Fbf1	C	T	11: 116,157,688		probably null	Het
Fndc9	C	T	11: 46,238,041	A129V	probably damaging	Het
Foxk2	CGGGGGG	CGGGGGGGGG	11: 121,260,491		probably benign	Het
Gba2	T	C	4: 43,568,000		probably null	Het
Gna12	T	A	5: 140,785,593	D61V	probably damaging	Het
Gpr37	C	T	6: 25,666,946		probably benign	Het
Grin2a	A	G	16: 9,761,965	F145L	possibly damaging	Het
Grin2b	C	A	6: 135,740,953	V714L	probably damaging	Het
Grm7	G	T	6: 110,646,348	V161F	probably damaging	Het
Hmcn1	G	T	1: 150,563,599	Y5494*	probably null	Het
Htr4	T	C	18: 62,428,126	S153P	probably damaging	Het
Igkv9-120	T	A	6: 68,050,144		probably benign	Het
Itgb6	T	C	2: 60,600,535	T772A	probably damaging	Het
Mgam	C	A	6: 40,652,715	A86E	possibly damaging	Het
Mme	T	A	3: 63,345,199	N421K	possibly damaging	Het
Mmp1b	C	T	9: 7,370,763	V331I	probably benign	Het
Naa16	A	G	14: 79,335,883	C816R	probably damaging	Het
Nav1	G	C	1: 135,450,644		probably null	Het
Nln	A	G	13: 104,025,025	M679T	probably damaging	Het
Olfr353	A	G	2: 36,890,524	L108P	probably damaging	Het
Olfr920	C	T	9: 38,756,036	T116I	possibly damaging	Het
Osbpl8	T	A	10: 111,269,436	S251T	probably benign	Het
Otop3	T	C	11: 115,344,558	F339L	probably damaging	Het
Pax7	T	C	4: 139,779,643	D361G	possibly damaging	Het
Peg10	C	T	6: 4,756,912		probably benign	Het
Poteg	A	T	8: 27,481,676	N406I	probably benign	Het
Rnf43	T	A	11: 87,732,267	N731K	probably benign	Het
Robo4	C	T	9: 37,404,476	R342*	probably null	Het
Sec23ip	G	A	7: 128,754,073	V307I	probably benign	Het
Slc2a4	T	A	11: 69,946,171	N116Y	probably damaging	Het
St5	T	C	7: 109,525,337	Q1099R	probably damaging	Het
Tas1r3	T	A	4: 155,860,202	Q854L	probably benign	Het
Tox3	G	A	8: 90,248,390	Q538*	probably null	Het
Trpm4	A	G	7: 45,310,598	F771S	probably damaging	Het
Tstd3	A	T	4: 21,759,375	F132L	possibly damaging	Het
Ulk2	T	C	11: 61,824,729		probably null	Het
Unc13b	T	C	4: 43,180,404	Y3080H	probably benign	Het
Vmn1r181	G	T	7: 23,984,518	S136I	possibly damaging	Het
Vmn2r114	A	T	17: 23,290,974	M844K	probably benign	Het
Vmn2r60	A	T	7: 42,136,433	H220L	probably benign	Het
Vps13a	A	G	19: 16,703,599	S1078P	probably damaging	Het
Vwa8	G	T	14: 78,947,142	R360L	probably benign	Het
Xlr4b	A	T	X: 73,215,332	Q25L	probably null	Het
Zdhhc22	T	A	12: 86,988,562	T39S	probably benign	Het
Zfp532	T	A	18: 65,656,626	H1045Q	possibly damaging	Het
Zfp773	AGCTGCTGCTGCTGCTGCTGCTGCTGC	AGCTGCTGCTGCTGCTGCTGCTGC	7: 7,133,093		probably benign	Het
Zfp964	G	C	8: 69,663,854	C368S	unknown	Het
Zfp985	G	A	4: 147,583,011	W112*	probably null	Het

Other mutations in Plekhh2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Plekhh2	APN	17	84521775	missense	probably benign	0.00
IGL00514:Plekhh2	APN	17	84596306	critical splice donor site	probably null
IGL00773:Plekhh2	APN	17	84606868	missense	probably benign	0.01
IGL00985:Plekhh2	APN	17	84563928	missense	probably benign	0.00
IGL01116:Plekhh2	APN	17	84606928	missense	possibly damaging	0.94
IGL01394:Plekhh2	APN	17	84557430	missense	probably benign	0.24
IGL01419:Plekhh2	APN	17	84583552	splice site	probably benign
IGL01932:Plekhh2	APN	17	84577261	missense	probably benign	0.00
IGL02097:Plekhh2	APN	17	84599180	missense	possibly damaging	0.69
IGL02157:Plekhh2	APN	17	84566942	splice site	probably benign
IGL02163:Plekhh2	APN	17	84590795	missense	probably benign	0.45
IGL02237:Plekhh2	APN	17	84575785	missense	probably benign	0.00
IGL02322:Plekhh2	APN	17	84589466	nonsense	probably null
IGL02422:Plekhh2	APN	17	84563809	splice site	probably benign
IGL02483:Plekhh2	APN	17	84596260	missense	possibly damaging	0.81
IGL02493:Plekhh2	APN	17	84606963	critical splice donor site	probably null
IGL03007:Plekhh2	APN	17	84574960	missense	possibly damaging	0.65
R0003:Plekhh2	UTSW	17	84557392	missense	probably damaging	1.00
R0005:Plekhh2	UTSW	17	84586433	missense	probably benign	0.16
R0099:Plekhh2	UTSW	17	84591672	nonsense	probably null
R0331:Plekhh2	UTSW	17	84586366	missense	possibly damaging	0.81
R0883:Plekhh2	UTSW	17	84618031	missense	probably benign	0.11
R1051:Plekhh2	UTSW	17	84521827	critical splice donor site	probably null
R1084:Plekhh2	UTSW	17	84571126	missense	probably damaging	0.99
R1351:Plekhh2	UTSW	17	84577146	splice site	probably benign
R1459:Plekhh2	UTSW	17	84610775	nonsense	probably null
R1469:Plekhh2	UTSW	17	84575771	missense	probably benign	0.03
R1469:Plekhh2	UTSW	17	84575771	missense	probably benign	0.03
R1510:Plekhh2	UTSW	17	84559576	splice site	probably null
R1699:Plekhh2	UTSW	17	84577184	nonsense	probably null
R1738:Plekhh2	UTSW	17	84566697	missense	possibly damaging	0.67
R1773:Plekhh2	UTSW	17	84599265	missense	probably damaging	1.00
R1796:Plekhh2	UTSW	17	84599133	critical splice acceptor site	probably null
R1823:Plekhh2	UTSW	17	84575189	missense	probably damaging	1.00
R1998:Plekhh2	UTSW	17	84606877	missense	possibly damaging	0.58
R2437:Plekhh2	UTSW	17	84586479	splice site	probably null
R4088:Plekhh2	UTSW	17	84617999	missense	probably benign	0.10
R4227:Plekhh2	UTSW	17	84566795	missense	probably benign	0.00
R4249:Plekhh2	UTSW	17	84586337	missense	possibly damaging	0.93
R4347:Plekhh2	UTSW	17	84619702	missense	probably benign	0.12
R4562:Plekhh2	UTSW	17	84566097	missense	probably benign	0.00
R4649:Plekhh2	UTSW	17	84575263	missense	probably damaging	1.00
R4737:Plekhh2	UTSW	17	84563959	missense	probably benign
R4743:Plekhh2	UTSW	17	84571120	missense	probably damaging	1.00
R4858:Plekhh2	UTSW	17	84600697	missense	probably damaging	1.00
R5036:Plekhh2	UTSW	17	84571761	missense	probably damaging	0.99
R5260:Plekhh2	UTSW	17	84577165	missense	probably damaging	0.99
R5385:Plekhh2	UTSW	17	84557466	missense	probably benign	0.00
R5409:Plekhh2	UTSW	17	84586478	critical splice donor site	probably null
R5510:Plekhh2	UTSW	17	84566847	missense	probably benign
R5557:Plekhh2	UTSW	17	84560152	missense	probably benign	0.10
R5684:Plekhh2	UTSW	17	84597918	missense	probably damaging	1.00
R5685:Plekhh2	UTSW	17	84569882	missense	probably damaging	1.00
R5724:Plekhh2	UTSW	17	84566805	missense	probably benign	0.00
R5742:Plekhh2	UTSW	17	84597980	missense	probably damaging	1.00
R5817:Plekhh2	UTSW	17	84571726	missense	possibly damaging	0.86
R6218:Plekhh2	UTSW	17	84591564	missense	probably benign	0.03
R6334:Plekhh2	UTSW	17	84566866	missense	probably benign
R6345:Plekhh2	UTSW	17	84575787	missense	probably benign	0.01
R6617:Plekhh2	UTSW	17	84566287	missense	possibly damaging	0.65
R6755:Plekhh2	UTSW	17	84591585	missense	probably damaging	1.00
R6864:Plekhh2	UTSW	17	84617999	missense	probably benign	0.10
R7171:Plekhh2	UTSW	17	84521788	missense	probably damaging	0.96
R7413:Plekhh2	UTSW	17	84566296	missense	probably benign	0.03
R7585:Plekhh2	UTSW	17	84577180	missense	probably benign	0.11
R7640:Plekhh2	UTSW	17	84610776	missense	possibly damaging	0.50
R7733:Plekhh2	UTSW	17	84583524	nonsense	probably null
R7877:Plekhh2	UTSW	17	84575006	missense	probably benign
R8085:Plekhh2	UTSW	17	84597956	missense	probably damaging	0.98
R8206:Plekhh2	UTSW	17	84590849	missense	possibly damaging	0.47
R8296:Plekhh2	UTSW	17	84600685	missense	probably damaging	0.98
R8344:Plekhh2	UTSW	17	84571761	missense	possibly damaging	0.64
R8438:Plekhh2	UTSW	17	84569951	missense	probably benign
R8487:Plekhh2	UTSW	17	84557481	missense	possibly damaging	0.55
R8708:Plekhh2	UTSW	17	84574993	missense	probably benign	0.00
R8830:Plekhh2	UTSW	17	84521803	missense	probably damaging	1.00
R8847:Plekhh2	UTSW	17	84571051	missense	probably benign	0.00
R8918:Plekhh2	UTSW	17	84599193	missense	possibly damaging	0.80
R9047:Plekhh2	UTSW	17	84590762	missense	probably damaging	0.99
R9404:Plekhh2	UTSW	17	84571040	critical splice acceptor site	probably null
R9428:Plekhh2	UTSW	17	84566413	missense	probably benign
R9516:Plekhh2	UTSW	17	84610812	missense	probably benign	0.00
R9559:Plekhh2	UTSW	17	84591589	missense	probably damaging	1.00
R9589:Plekhh2	UTSW	17	84547490	missense	possibly damaging	0.90
R9641:Plekhh2	UTSW	17	84566702	missense	probably damaging	1.00
R9659:Plekhh2	UTSW	17	84547464	missense	possibly damaging	0.95
R9788:Plekhh2	UTSW	17	84547464	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- ACTTCATGAGGATGTCTGAGTCTG -3'
(R):5'- GGAAGCATTCTCCGATTTGTAC -3'

Sequencing Primer
(F):5'- TGCAAAATTAAAGAAACTGGAGTCC -3'
(R):5'- GCATTCTCCGATTTGTACAATAATGC -3'

Posted On

2014-12-04