Incidental Mutation 'R2848:Diexf'
ID251786
Institutional Source Beutler Lab
Gene Symbol Diexf
Ensembl Gene ENSMUSG00000016181
Gene Namedigestive organ expansion factor homolog (zebrafish)
SynonymsAA408296
MMRRC Submission 040441-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R2848 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location193091104-193130272 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 193128451 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 81 (N81K)
Ref Sequence ENSEMBL: ENSMUSP00000141676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085555] [ENSMUST00000195291] [ENSMUST00000195848]
Predicted Effect probably benign
Transcript: ENSMUST00000085555
AA Change: N81K

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000082691
Gene: ENSMUSG00000016181
AA Change: N81K

DomainStartEndE-ValueType
low complexity region 51 70 N/A INTRINSIC
coiled coil region 72 113 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 217 224 N/A INTRINSIC
Pfam:UTP25 288 763 6.1e-200 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194335
Predicted Effect probably benign
Transcript: ENSMUST00000195291
AA Change: N81K

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141676
Gene: ENSMUSG00000016181
AA Change: N81K

DomainStartEndE-ValueType
low complexity region 51 70 N/A INTRINSIC
coiled coil region 72 113 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 217 224 N/A INTRINSIC
Pfam:DUF1253 325 634 6.9e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195848
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451I11Rik A T 7: 126,830,722 F101Y possibly damaging Het
A230050P20Rik A T 9: 20,873,572 H225L probably damaging Het
Abca17 G C 17: 24,289,507 T1018R probably damaging Het
Adamts14 T A 10: 61,218,435 Q606L probably damaging Het
Adgrf5 C A 17: 43,422,640 N118K possibly damaging Het
Baz2b A T 2: 59,924,666 Y1073N possibly damaging Het
Celf2 T C 2: 6,604,125 R282G probably damaging Het
Cntnap5c A T 17: 57,876,392 D31V probably damaging Het
Cobl A G 11: 12,378,342 L81P probably damaging Het
Cpsf1 A T 15: 76,602,851 L209Q probably damaging Het
Crocc G A 4: 141,018,756 A1684V probably damaging Het
Cyp4f37 T A 17: 32,629,125 C206S probably damaging Het
Dnah3 A G 7: 119,967,938 V2355A probably benign Het
Dnah6 T C 6: 73,129,331 K1756E probably benign Het
Fis1 T C 5: 136,963,117 I55T possibly damaging Het
Gm2381 G A 7: 42,820,407 P98S probably damaging Het
Gpr37 C T 6: 25,666,946 probably benign Het
Grin2a A G 16: 9,761,965 F145L possibly damaging Het
Htr4 T C 18: 62,428,126 S153P probably damaging Het
Igkv9-120 T A 6: 68,050,144 probably benign Het
Il12rb1 G A 8: 70,815,802 W396* probably null Het
Itga8 A T 2: 12,160,404 V798D probably damaging Het
Lfng T A 5: 140,611,867 D149E probably damaging Het
Magi2 A AG 5: 20,602,461 probably null Het
Mgam C A 6: 40,652,715 A86E possibly damaging Het
Myh4 A G 11: 67,248,633 N592S probably benign Het
Naa16 A G 14: 79,335,883 C816R probably damaging Het
Nek8 A G 11: 78,168,141 S513P probably damaging Het
Ociad1 A G 5: 73,294,351 probably null Het
Olfr1288 T C 2: 111,479,354 M190T probably benign Het
Olfr350 A G 2: 36,850,799 Y251C probably damaging Het
Olfr721-ps1 C T 14: 14,407,398 P57S probably damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Pcdh7 G A 5: 57,720,276 G391E probably damaging Het
Pcdhga10 T A 18: 37,748,200 V338E possibly damaging Het
Pde4b C T 4: 102,601,545 A466V probably damaging Het
Peg10 C T 6: 4,756,912 probably benign Het
Poteg A T 8: 27,481,676 N406I probably benign Het
Ppargc1a A G 5: 51,473,809 F493L probably benign Het
Ptpra C A 2: 130,544,999 H603Q probably benign Het
Rnf10 T C 5: 115,249,112 D439G probably benign Het
Syt3 G A 7: 44,393,442 V383I probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Try5 C T 6: 41,313,476 V25I probably benign Het
Ttn G T 2: 76,919,207 Q3833K probably benign Het
Usp53 G A 3: 122,934,491 P814L probably benign Het
Vmn1r181 G T 7: 23,984,518 S136I possibly damaging Het
Vmn2r114 A T 17: 23,290,974 M844K probably benign Het
Vwa8 G T 14: 78,947,142 R360L probably benign Het
Xlr4b A T X: 73,215,332 Q25L probably null Het
Zfp532 T A 18: 65,656,626 H1045Q possibly damaging Het
Zfp985 G A 4: 147,583,011 W112* probably null Het
Other mutations in Diexf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Diexf APN 1 193115001 missense probably damaging 1.00
IGL01700:Diexf APN 1 193118265 missense probably damaging 1.00
IGL02076:Diexf APN 1 193130059 missense probably damaging 1.00
IGL02121:Diexf APN 1 193118278 missense probably benign 0.05
IGL02666:Diexf APN 1 193107596 nonsense probably null
IGL02997:Diexf APN 1 193120584 missense probably benign 0.34
3-1:Diexf UTSW 1 193118280 missense probably benign 0.07
R0099:Diexf UTSW 1 193128470 missense probably damaging 1.00
R0395:Diexf UTSW 1 193123676 missense possibly damaging 0.69
R0502:Diexf UTSW 1 193114828 splice site probably benign
R0973:Diexf UTSW 1 193114703 missense probably damaging 0.98
R0973:Diexf UTSW 1 193114703 missense probably damaging 0.98
R0974:Diexf UTSW 1 193114703 missense probably damaging 0.98
R1815:Diexf UTSW 1 193118283 missense probably benign 0.26
R1930:Diexf UTSW 1 193118309 missense probably damaging 1.00
R1931:Diexf UTSW 1 193118309 missense probably damaging 1.00
R1937:Diexf UTSW 1 193122093 missense probably damaging 1.00
R2847:Diexf UTSW 1 193128451 missense probably benign 0.41
R3412:Diexf UTSW 1 193128502 missense possibly damaging 0.93
R3414:Diexf UTSW 1 193128502 missense possibly damaging 0.93
R4471:Diexf UTSW 1 193130137 missense possibly damaging 0.68
R4627:Diexf UTSW 1 193107695 missense probably benign 0.00
R4644:Diexf UTSW 1 193128480 missense probably damaging 1.00
R4761:Diexf UTSW 1 193113922 missense probably damaging 1.00
R4791:Diexf UTSW 1 193128267 missense probably benign
R4793:Diexf UTSW 1 193113808 missense probably null 0.56
R4858:Diexf UTSW 1 193113764 missense probably damaging 1.00
R4944:Diexf UTSW 1 193114954 missense probably damaging 1.00
R5162:Diexf UTSW 1 193113781 missense probably damaging 1.00
R5347:Diexf UTSW 1 193128379 missense probably benign
R5837:Diexf UTSW 1 193118393 missense probably damaging 1.00
R6113:Diexf UTSW 1 193129502 missense probably null 0.01
R6455:Diexf UTSW 1 193128376 missense probably benign 0.07
R6563:Diexf UTSW 1 193118390 missense probably damaging 1.00
R6636:Diexf UTSW 1 193113767 missense probably damaging 1.00
R7018:Diexf UTSW 1 193114855 missense probably benign 0.06
R7037:Diexf UTSW 1 193120723 splice site probably null
R8027:Diexf UTSW 1 193118222 missense probably benign
R8042:Diexf UTSW 1 193114672 missense
RF021:Diexf UTSW 1 193120666 missense probably benign
X0050:Diexf UTSW 1 193123732 missense probably benign 0.23
Z1177:Diexf UTSW 1 193114675 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTTCCTGTGTCTCAGCAG -3'
(R):5'- AGTAGCGGGTTTCCTAAGGAC -3'

Sequencing Primer
(F):5'- GTGTCTCAGCAGCCTCCTCAG -3'
(R):5'- CGGGTTTCCTAAGGACTTTTCCAG -3'
Posted On2014-12-04