Mutagenetix > Incidental Mutation

Incidental Mutation 'R2848:Baz2b'

251796

Institutional Source

Beutler Lab

Gene Symbol

Baz2b

Ensembl Gene

ENSMUSG00000026987

Gene Name

bromodomain adjacent to zinc finger domain, 2B

Synonyms

D2Ertd794e, 5830435C13Rik

MMRRC Submission

040441-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.321) question?

Stock #

R2848 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

59899363-60209839 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 59924666 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 1073 (Y1073N)

Ref Sequence

ENSEMBL: ENSMUSP00000108169 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090925] [ENSMUST00000112550] [ENSMUST00000153136]

AlphaFold

A2AUY4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090925
AA Change: Y1073N

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000088443
Gene: ENSMUSG00000026987
AA Change: Y1073N

Domain	Start	End	E-Value	Type
low complexity region	7	46	N/A	INTRINSIC
low complexity region	82	97	N/A	INTRINSIC
low complexity region	147	162	N/A	INTRINSIC
low complexity region	193	244	N/A	INTRINSIC
low complexity region	291	308	N/A	INTRINSIC
low complexity region	366	385	N/A	INTRINSIC
low complexity region	528	540	N/A	INTRINSIC
low complexity region	554	614	N/A	INTRINSIC
low complexity region	628	637	N/A	INTRINSIC
low complexity region	671	685	N/A	INTRINSIC
Pfam:MBD	690	742	1e-12	PFAM
low complexity region	759	774	N/A	INTRINSIC
coiled coil region	814	975	N/A	INTRINSIC
DDT	1004	1069	1.19e-20	SMART
low complexity region	1199	1212	N/A	INTRINSIC
low complexity region	1213	1247	N/A	INTRINSIC
coiled coil region	1251	1286	N/A	INTRINSIC
low complexity region	1320	1337	N/A	INTRINSIC
low complexity region	1503	1524	N/A	INTRINSIC
low complexity region	1569	1582	N/A	INTRINSIC
low complexity region	1585	1605	N/A	INTRINSIC
Blast:BROMO	1802	1843	7e-18	BLAST
PHD	1888	1934	1.71e-12	SMART
low complexity region	1942	1964	N/A	INTRINSIC
low complexity region	1968	1980	N/A	INTRINSIC
BROMO	2013	2121	3.85e-41	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112550
AA Change: Y1073N

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000108169
Gene: ENSMUSG00000026987
AA Change: Y1073N

Domain	Start	End	E-Value	Type
low complexity region	7	46	N/A	INTRINSIC
low complexity region	82	97	N/A	INTRINSIC
low complexity region	147	162	N/A	INTRINSIC
low complexity region	193	244	N/A	INTRINSIC
low complexity region	291	308	N/A	INTRINSIC
low complexity region	366	385	N/A	INTRINSIC
low complexity region	528	540	N/A	INTRINSIC
low complexity region	554	614	N/A	INTRINSIC
low complexity region	628	637	N/A	INTRINSIC
low complexity region	671	685	N/A	INTRINSIC
Pfam:MBD	690	741	3.4e-13	PFAM
low complexity region	759	774	N/A	INTRINSIC
coiled coil region	814	975	N/A	INTRINSIC
DDT	1004	1069	1.19e-20	SMART
low complexity region	1199	1212	N/A	INTRINSIC
low complexity region	1213	1247	N/A	INTRINSIC
coiled coil region	1251	1286	N/A	INTRINSIC
low complexity region	1320	1337	N/A	INTRINSIC
low complexity region	1503	1524	N/A	INTRINSIC
low complexity region	1569	1582	N/A	INTRINSIC
low complexity region	1585	1605	N/A	INTRINSIC
Pfam:WHIM3	1638	1676	5.1e-14	PFAM
Blast:BROMO	1802	1843	7e-18	BLAST
PHD	1888	1934	1.71e-12	SMART
low complexity region	1942	1964	N/A	INTRINSIC
low complexity region	1968	1980	N/A	INTRINSIC
BROMO	2013	2121	3.85e-41	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147476

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152639

Predicted Effect

probably benign
Transcript: ENSMUST00000153136

SMART Domains

Protein: ENSMUSP00000118981
Gene: ENSMUSG00000026987

Domain	Start	End	E-Value	Type
coiled coil region	48	218	N/A	INTRINSIC
Pfam:DDT	247	296	1.6e-13	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the bromodomain gene family. Members of this gene family encode proteins that are integral components of chromatin remodeling complexes. The encoded protein showed strong preference for the activating H3K14Ac mark in a histone peptide screen, suggesting a potential role in transcriptional activation. This gene may be associated with susceptibility to sudden cardiac death (SCD). [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930451I11Rik	A	T	7: 126,830,722	F101Y	possibly damaging	Het
A230050P20Rik	A	T	9: 20,873,572	H225L	probably damaging	Het
Abca17	G	C	17: 24,289,507	T1018R	probably damaging	Het
Adamts14	T	A	10: 61,218,435	Q606L	probably damaging	Het
Adgrf5	C	A	17: 43,422,640	N118K	possibly damaging	Het
Celf2	T	C	2: 6,604,125	R282G	probably damaging	Het
Cntnap5c	A	T	17: 57,876,392	D31V	probably damaging	Het
Cobl	A	G	11: 12,378,342	L81P	probably damaging	Het
Cpsf1	A	T	15: 76,602,851	L209Q	probably damaging	Het
Crocc	G	A	4: 141,018,756	A1684V	probably damaging	Het
Cyp4f37	T	A	17: 32,629,125	C206S	probably damaging	Het
Diexf	A	T	1: 193,128,451	N81K	probably benign	Het
Dnah3	A	G	7: 119,967,938	V2355A	probably benign	Het
Dnah6	T	C	6: 73,129,331	K1756E	probably benign	Het
Fis1	T	C	5: 136,963,117	I55T	possibly damaging	Het
Gm2381	G	A	7: 42,820,407	P98S	probably damaging	Het
Gpr37	C	T	6: 25,666,946		probably benign	Het
Grin2a	A	G	16: 9,761,965	F145L	possibly damaging	Het
Htr4	T	C	18: 62,428,126	S153P	probably damaging	Het
Igkv9-120	T	A	6: 68,050,144		probably benign	Het
Il12rb1	G	A	8: 70,815,802	W396*	probably null	Het
Itga8	A	T	2: 12,160,404	V798D	probably damaging	Het
Lfng	T	A	5: 140,611,867	D149E	probably damaging	Het
Magi2	A	AG	5: 20,602,461		probably null	Het
Mgam	C	A	6: 40,652,715	A86E	possibly damaging	Het
Myh4	A	G	11: 67,248,633	N592S	probably benign	Het
Naa16	A	G	14: 79,335,883	C816R	probably damaging	Het
Nek8	A	G	11: 78,168,141	S513P	probably damaging	Het
Ociad1	A	G	5: 73,294,351		probably null	Het
Olfr1288	T	C	2: 111,479,354	M190T	probably benign	Het
Olfr350	A	G	2: 36,850,799	Y251C	probably damaging	Het
Olfr721-ps1	C	T	14: 14,407,398	P57S	probably damaging	Het
Osbpl8	T	A	10: 111,269,436	S251T	probably benign	Het
Pcdh7	G	A	5: 57,720,276	G391E	probably damaging	Het
Pcdhga10	T	A	18: 37,748,200	V338E	possibly damaging	Het
Pde4b	C	T	4: 102,601,545	A466V	probably damaging	Het
Peg10	C	T	6: 4,756,912		probably benign	Het
Poteg	A	T	8: 27,481,676	N406I	probably benign	Het
Ppargc1a	A	G	5: 51,473,809	F493L	probably benign	Het
Ptpra	C	A	2: 130,544,999	H603Q	probably benign	Het
Rnf10	T	C	5: 115,249,112	D439G	probably benign	Het
Syt3	G	A	7: 44,393,442	V383I	probably benign	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Try5	C	T	6: 41,313,476	V25I	probably benign	Het
Ttn	G	T	2: 76,919,207	Q3833K	probably benign	Het
Usp53	G	A	3: 122,934,491	P814L	probably benign	Het
Vmn1r181	G	T	7: 23,984,518	S136I	possibly damaging	Het
Vmn2r114	A	T	17: 23,290,974	M844K	probably benign	Het
Vwa8	G	T	14: 78,947,142	R360L	probably benign	Het
Xlr4b	A	T	X: 73,215,332	Q25L	probably null	Het
Zfp532	T	A	18: 65,656,626	H1045Q	possibly damaging	Het
Zfp985	G	A	4: 147,583,011	W112*	probably null	Het

Other mutations in Baz2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Baz2b	APN	2	59912795	missense	probably benign	0.02
IGL00476:Baz2b	APN	2	59913739	missense	probably benign	0.06
IGL00489:Baz2b	APN	2	59957675	nonsense	probably null
IGL00514:Baz2b	APN	2	59962477	missense	probably benign	0.11
IGL00678:Baz2b	APN	2	60006183	missense	unknown
IGL01348:Baz2b	APN	2	59933687	missense	possibly damaging	0.95
IGL01354:Baz2b	APN	2	59968889	missense	probably benign	0.18
IGL01924:Baz2b	APN	2	59935271	missense	probably damaging	1.00
IGL02125:Baz2b	APN	2	59968640	missense	probably benign	0.12
IGL02314:Baz2b	APN	2	59962227	missense	probably benign
IGL02370:Baz2b	APN	2	59923589	missense	possibly damaging	0.77
IGL02473:Baz2b	APN	2	59960063	missense	probably benign	0.40
IGL02499:Baz2b	APN	2	59901496	missense	possibly damaging	0.60
IGL02609:Baz2b	APN	2	59917369	missense	possibly damaging	0.77
IGL02705:Baz2b	APN	2	59948260	missense	possibly damaging	0.92
IGL02711:Baz2b	APN	2	59917505	unclassified	probably benign
IGL02716:Baz2b	APN	2	59962524	missense	possibly damaging	0.53
IGL02724:Baz2b	APN	2	59977374	missense	possibly damaging	0.70
IGL02750:Baz2b	APN	2	59968658	missense	possibly damaging	0.73
IGL02869:Baz2b	APN	2	59977528	missense	probably benign	0.00
IGL02886:Baz2b	APN	2	59957743	splice site	probably null
IGL02892:Baz2b	APN	2	59900736	missense	probably damaging	1.00
IGL03132:Baz2b	APN	2	59907753	splice site	probably benign
IGL03183:Baz2b	APN	2	59903296	missense	probably benign	0.10
IGL03197:Baz2b	APN	2	59901554	missense	possibly damaging	0.74
R0054:Baz2b	UTSW	2	59932166	missense	probably damaging	1.00
R0054:Baz2b	UTSW	2	59932166	missense	probably damaging	1.00
R0122:Baz2b	UTSW	2	59913619	splice site	probably null
R0136:Baz2b	UTSW	2	59901954	missense	probably benign	0.22
R0144:Baz2b	UTSW	2	59907495	missense	probably damaging	0.98
R0403:Baz2b	UTSW	2	59969377	missense	possibly damaging	0.70
R0498:Baz2b	UTSW	2	59901996	unclassified	probably benign
R0528:Baz2b	UTSW	2	59936739	missense	probably damaging	1.00
R1025:Baz2b	UTSW	2	59962482	missense	probably benign	0.06
R1470:Baz2b	UTSW	2	59978546	missense	possibly damaging	0.53
R1470:Baz2b	UTSW	2	59978546	missense	possibly damaging	0.53
R1510:Baz2b	UTSW	2	59922209	missense	probably damaging	1.00
R1511:Baz2b	UTSW	2	59962024	missense	probably benign	0.12
R1514:Baz2b	UTSW	2	59962326	missense	probably benign	0.13
R1519:Baz2b	UTSW	2	59948254	missense	possibly damaging	0.50
R1523:Baz2b	UTSW	2	59968637	missense	possibly damaging	0.47
R1630:Baz2b	UTSW	2	60006130	missense	unknown
R1641:Baz2b	UTSW	2	59912890	missense	probably damaging	0.99
R1674:Baz2b	UTSW	2	59912992	missense	possibly damaging	0.53
R1778:Baz2b	UTSW	2	60006136	missense	unknown
R1826:Baz2b	UTSW	2	59968733	missense	probably benign	0.12
R1835:Baz2b	UTSW	2	59901819	missense	probably benign	0.02
R1954:Baz2b	UTSW	2	59968743	missense	probably benign	0.12
R1981:Baz2b	UTSW	2	59923680	missense	possibly damaging	0.95
R2029:Baz2b	UTSW	2	59912723	unclassified	probably benign
R2567:Baz2b	UTSW	2	59913911	missense	possibly damaging	0.82
R2842:Baz2b	UTSW	2	59913004	missense	probably benign	0.27
R3809:Baz2b	UTSW	2	59968896	missense	probably benign	0.12
R3935:Baz2b	UTSW	2	59912761	missense	possibly damaging	0.81
R3936:Baz2b	UTSW	2	59912761	missense	possibly damaging	0.81
R4072:Baz2b	UTSW	2	59912573	splice site	probably null
R4182:Baz2b	UTSW	2	60098457	intron	probably benign
R4255:Baz2b	UTSW	2	59920572	unclassified	probably benign
R4359:Baz2b	UTSW	2	59901613	missense	possibly damaging	0.87
R4716:Baz2b	UTSW	2	59969255	missense	probably benign	0.06
R4743:Baz2b	UTSW	2	59913911	missense	probably benign	0.01
R4772:Baz2b	UTSW	2	59958451	missense	probably damaging	0.96
R4858:Baz2b	UTSW	2	59907743	missense	probably benign
R4868:Baz2b	UTSW	2	59924882	missense	possibly damaging	0.65
R4872:Baz2b	UTSW	2	59942759	splice site	probably null
R4889:Baz2b	UTSW	2	59936726	missense	probably damaging	1.00
R4890:Baz2b	UTSW	2	59926039	missense	probably damaging	0.99
R4914:Baz2b	UTSW	2	59914043	missense	possibly damaging	0.70
R4915:Baz2b	UTSW	2	59914043	missense	possibly damaging	0.70
R4918:Baz2b	UTSW	2	59914043	missense	possibly damaging	0.70
R5027:Baz2b	UTSW	2	60098644	intron	probably benign
R5031:Baz2b	UTSW	2	59912807	missense	probably benign	0.00
R5082:Baz2b	UTSW	2	59901491	nonsense	probably null
R5133:Baz2b	UTSW	2	59962024	missense	probably benign	0.12
R5276:Baz2b	UTSW	2	59962614	missense	probably benign	0.40
R5279:Baz2b	UTSW	2	59932152	missense	probably damaging	1.00
R5294:Baz2b	UTSW	2	59978602	missense	probably benign	0.11
R5447:Baz2b	UTSW	2	59913988	missense	probably damaging	0.99
R5903:Baz2b	UTSW	2	59959889	missense	probably damaging	0.99
R5910:Baz2b	UTSW	2	59977426	missense	possibly damaging	0.88
R6140:Baz2b	UTSW	2	59912527	missense	probably damaging	0.99
R6195:Baz2b	UTSW	2	59907511	missense	possibly damaging	0.89
R6199:Baz2b	UTSW	2	59978675	missense	probably benign	0.00
R6208:Baz2b	UTSW	2	59924806	missense	probably damaging	1.00
R6233:Baz2b	UTSW	2	59907511	missense	possibly damaging	0.89
R6276:Baz2b	UTSW	2	59948223	missense	probably damaging	1.00
R6324:Baz2b	UTSW	2	59906948	missense	probably damaging	1.00
R6490:Baz2b	UTSW	2	59901729	missense	probably damaging	1.00
R6578:Baz2b	UTSW	2	59969279	missense	possibly damaging	0.47
R6720:Baz2b	UTSW	2	59924890	missense	probably damaging	1.00
R6760:Baz2b	UTSW	2	59962432	missense	probably benign	0.40
R6836:Baz2b	UTSW	2	59917425	missense	probably damaging	1.00
R6859:Baz2b	UTSW	2	59901530	missense	probably benign	0.01
R6880:Baz2b	UTSW	2	59912939	missense	probably damaging	0.99
R6916:Baz2b	UTSW	2	59968776	missense	probably benign
R6978:Baz2b	UTSW	2	59907715	missense	possibly damaging	0.84
R7037:Baz2b	UTSW	2	59933670	critical splice donor site	probably null
R7112:Baz2b	UTSW	2	59962184	missense	possibly damaging	0.53
R7117:Baz2b	UTSW	2	59912497	missense
R7198:Baz2b	UTSW	2	59962206	missense	probably benign	0.00
R7270:Baz2b	UTSW	2	59962492	missense	possibly damaging	0.96
R7282:Baz2b	UTSW	2	59920437	missense	probably benign	0.17
R7464:Baz2b	UTSW	2	59977448	missense	possibly damaging	0.53
R7609:Baz2b	UTSW	2	59962473	missense	probably benign	0.40
R7703:Baz2b	UTSW	2	59917425	missense	probably damaging	1.00
R7850:Baz2b	UTSW	2	59936716	missense	probably damaging	0.98
R7851:Baz2b	UTSW	2	59936716	missense	probably damaging	0.98
R7988:Baz2b	UTSW	2	59962141	missense	possibly damaging	0.53
R8079:Baz2b	UTSW	2	59900768	missense	probably damaging	1.00
R8084:Baz2b	UTSW	2	59962236	missense	probably benign
R8343:Baz2b	UTSW	2	59901514	missense	probably damaging	1.00
R8348:Baz2b	UTSW	2	59911793	missense
R8438:Baz2b	UTSW	2	59917484	nonsense	probably null
R8448:Baz2b	UTSW	2	59911793	missense
R8511:Baz2b	UTSW	2	59901814	missense	probably benign
R8893:Baz2b	UTSW	2	59924805	missense	probably damaging	0.96
R8947:Baz2b	UTSW	2	59948239	missense	probably benign	0.06
R8998:Baz2b	UTSW	2	59969264	missense	probably benign	0.02
R9241:Baz2b	UTSW	2	59913649	missense	probably benign	0.01
R9245:Baz2b	UTSW	2	59912987	missense	probably benign
R9577:Baz2b	UTSW	2	59978687	missense	probably benign	0.06
R9581:Baz2b	UTSW	2	59968956	missense	probably benign
R9601:Baz2b	UTSW	2	59901503	missense	possibly damaging	0.66
R9613:Baz2b	UTSW	2	59901480	missense	probably benign	0.09
R9639:Baz2b	UTSW	2	59901484	missense	probably benign	0.01
X0011:Baz2b	UTSW	2	59977361	missense	possibly damaging	0.53
X0053:Baz2b	UTSW	2	59900675	missense	probably damaging	1.00
X0064:Baz2b	UTSW	2	59969282	missense	probably benign
Z1088:Baz2b	UTSW	2	59960015	missense	probably damaging	1.00
Z1177:Baz2b	UTSW	2	59977520	missense	probably benign	0.01
Z1188:Baz2b	UTSW	2	59977405	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACTGAGAGACGGTCTGGTTC -3'
(R):5'- TGCAGTTCTTACGAAACTTTGG -3'

Sequencing Primer
(F):5'- ACTGAGAGACGGTCTGGTTCATATTC -3'
(R):5'- GCAGTTCTTACGAAACTTTGGTAAAG -3'

Posted On

2014-12-04