Incidental Mutation 'R0311:Rnf207'
ID25180
Institutional Source Beutler Lab
Gene Symbol Rnf207
Ensembl Gene ENSMUSG00000058498
Gene Namering finger protein 207
Synonyms
MMRRC Submission 038521-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R0311 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location152307019-152318993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 152315779 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 175 (C175R)
Ref Sequence ENSEMBL: ENSMUSP00000129400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076183] [ENSMUST00000130008] [ENSMUST00000170820]
Predicted Effect probably damaging
Transcript: ENSMUST00000076183
AA Change: C175R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075540
Gene: ENSMUSG00000058498
AA Change: C175R

DomainStartEndE-ValueType
RING 25 63 1.16e-5 SMART
Pfam:zf-B_box 93 145 3.6e-11 PFAM
Pfam:DUF3583 204 378 1.2e-10 PFAM
coiled coil region 422 461 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127565
Predicted Effect probably benign
Transcript: ENSMUST00000130008
SMART Domains Protein: ENSMUSP00000127196
Gene: ENSMUSG00000058498

DomainStartEndE-ValueType
RING 25 63 5.6e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146496
Predicted Effect probably damaging
Transcript: ENSMUST00000170820
AA Change: C175R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129400
Gene: ENSMUSG00000058498
AA Change: C175R

DomainStartEndE-ValueType
RING 25 63 1.16e-5 SMART
Pfam:zf-B_box 93 145 1e-11 PFAM
low complexity region 236 242 N/A INTRINSIC
low complexity region 315 326 N/A INTRINSIC
coiled coil region 387 426 N/A INTRINSIC
Meta Mutation Damage Score 0.9404 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.6%
  • 20x: 91.6%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A C 7: 120,402,904 M1547L probably damaging Het
Abcb4 A G 5: 8,934,243 K658E probably benign Het
Abr A G 11: 76,509,127 S15P possibly damaging Het
Adgrb2 G C 4: 130,017,129 A1168P probably damaging Het
Adgre4 A T 17: 55,802,010 E339V probably benign Het
Asprv1 T C 6: 86,628,840 W223R probably damaging Het
Ccdc89 A G 7: 90,426,693 E37G probably damaging Het
Cd48 C A 1: 171,699,580 Y191* probably null Het
Chd4 T C 6: 125,101,665 I257T probably benign Het
Clca4b T C 3: 144,932,496 M2V probably benign Het
Dnah11 A T 12: 118,127,133 D1025E probably benign Het
Erich5 A G 15: 34,472,939 *363W probably null Het
Etl4 A G 2: 20,807,129 D1341G probably damaging Het
Fbxw11 A G 11: 32,722,083 T184A probably benign Het
Fktn A G 4: 53,744,620 Q300R probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gdpd3 G A 7: 126,767,189 R66Q possibly damaging Het
Hexb A G 13: 97,183,819 probably benign Het
Kdm4b A G 17: 56,386,200 R346G probably benign Het
Mbtd1 T A 11: 93,921,357 probably null Het
Med23 T A 10: 24,897,358 C653S possibly damaging Het
Nwd2 A T 5: 63,804,998 I642L probably damaging Het
Olfr1444 A G 19: 12,861,869 I31M probably benign Het
Olfr1448 T A 19: 12,920,096 Y71F possibly damaging Het
Olfr912 T C 9: 38,539,297 V134A probably benign Het
Pbld2 T C 10: 63,054,507 probably null Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Plpp2 C T 10: 79,527,580 R77K probably damaging Het
Pym1 G T 10: 128,765,984 R168L possibly damaging Het
Rbm4 T C 19: 4,787,556 Y300C probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Speg T C 1: 75,430,937 V3196A probably damaging Het
Syne1 T A 10: 5,348,943 I1048L possibly damaging Het
Th T C 7: 142,896,041 E41G probably damaging Het
Tmx4 T A 2: 134,598,526 *336L probably null Het
Tnfrsf18 T C 4: 156,026,415 V10A possibly damaging Het
Tnxb A T 17: 34,716,984 I2670F probably damaging Het
Tpx2 T C 2: 152,890,492 V562A probably damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Vps18 T C 2: 119,297,365 Y890H probably benign Het
Ythdc1 G A 5: 86,835,705 D670N probably damaging Het
Other mutations in Rnf207
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01643:Rnf207 APN 4 152318261 splice site probably benign
IGL02325:Rnf207 APN 4 152311780 missense probably damaging 0.97
IGL02451:Rnf207 APN 4 152312412 missense probably benign 0.25
R0462:Rnf207 UTSW 4 152313372 missense possibly damaging 0.78
R0671:Rnf207 UTSW 4 152307468 missense probably benign 0.00
R0845:Rnf207 UTSW 4 152312064 splice site probably benign
R1544:Rnf207 UTSW 4 152313871 splice site probably benign
R1667:Rnf207 UTSW 4 152313215 missense probably benign 0.00
R4052:Rnf207 UTSW 4 152311437 missense probably benign 0.41
R4335:Rnf207 UTSW 4 152315605 splice site probably benign
R4649:Rnf207 UTSW 4 152312155 missense probably benign 0.06
R5033:Rnf207 UTSW 4 152313209 missense probably benign 0.00
R5268:Rnf207 UTSW 4 152313889 missense probably damaging 1.00
R5603:Rnf207 UTSW 4 152312394 missense probably damaging 1.00
R5938:Rnf207 UTSW 4 152317928 intron probably benign
R6147:Rnf207 UTSW 4 152315655 missense probably damaging 1.00
R6181:Rnf207 UTSW 4 152308848 missense probably benign 0.00
R6866:Rnf207 UTSW 4 152312532 missense possibly damaging 0.81
R7166:Rnf207 UTSW 4 152311780 missense probably damaging 0.98
R7177:Rnf207 UTSW 4 152312177 missense probably benign 0.43
R7354:Rnf207 UTSW 4 152314091 missense probably damaging 0.96
R7893:Rnf207 UTSW 4 152311438 missense probably damaging 0.99
R7976:Rnf207 UTSW 4 152311438 missense probably damaging 0.99
X0026:Rnf207 UTSW 4 152316042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGAACAGCAGGATCTCAACTC -3'
(R):5'- GCGACGTGATCCAGAAGTGTAGTG -3'

Sequencing Primer
(F):5'- GGGTTCTCACAACTCCCAC -3'
(R):5'- GTGTAGTGAGTGAGGCATACC -3'
Posted On2013-04-16