Incidental Mutation 'R2848:Pde4b'
ID251806
Institutional Source Beutler Lab
Gene Symbol Pde4b
Ensembl Gene ENSMUSG00000028525
Gene Namephosphodiesterase 4B, cAMP specific
Synonymsdunce, Dpde4
MMRRC Submission 040441-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R2848 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location102087543-102607259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102601545 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 466 (A466V)
Ref Sequence ENSEMBL: ENSMUSP00000102524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030251] [ENSMUST00000097949] [ENSMUST00000097950] [ENSMUST00000106901] [ENSMUST00000106904] [ENSMUST00000106908] [ENSMUST00000106911]
Predicted Effect probably damaging
Transcript: ENSMUST00000030251
AA Change: A214V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030251
Gene: ENSMUSG00000028525
AA Change: A214V

DomainStartEndE-ValueType
HDc 151 326 2.35e-5 SMART
low complexity region 433 446 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097949
AA Change: A233V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095561
Gene: ENSMUSG00000028525
AA Change: A233V

DomainStartEndE-ValueType
HDc 170 345 2.35e-5 SMART
low complexity region 452 465 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097950
AA Change: A294V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095562
Gene: ENSMUSG00000028525
AA Change: A294V

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
HDc 231 406 2.35e-5 SMART
low complexity region 513 526 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106901
AA Change: A233V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102514
Gene: ENSMUSG00000028525
AA Change: A233V

DomainStartEndE-ValueType
HDc 170 345 2.35e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106904
AA Change: A389V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102517
Gene: ENSMUSG00000028525
AA Change: A389V

DomainStartEndE-ValueType
HDc 326 501 2.35e-5 SMART
low complexity region 608 621 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106908
AA Change: A451V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102521
Gene: ENSMUSG00000028525
AA Change: A451V

DomainStartEndE-ValueType
HDc 388 563 2.35e-5 SMART
low complexity region 670 683 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106911
AA Change: A466V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102524
Gene: ENSMUSG00000028525
AA Change: A466V

DomainStartEndE-ValueType
low complexity region 23 33 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
HDc 403 578 2.35e-5 SMART
low complexity region 685 698 N/A INTRINSIC
Meta Mutation Damage Score 0.9335 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type IV, cyclic AMP (cAMP)-specific, cyclic nucleotide phosphodiesterase (PDE) family. The encoded protein regulates the cellular concentrations of cyclic nucleotides and thereby play a role in signal transduction. Altered activity of this protein has been associated with schizophrenia and bipolar affective disorder. Alternative splicing and the use of alternative promoters results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene produce significantly less TNF-alpha in response to lipopolysaccharide stimulation. One mutation resulted in brain and spinal cord vacuoles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451I11Rik A T 7: 126,830,722 F101Y possibly damaging Het
A230050P20Rik A T 9: 20,873,572 H225L probably damaging Het
Abca17 G C 17: 24,289,507 T1018R probably damaging Het
Adamts14 T A 10: 61,218,435 Q606L probably damaging Het
Adgrf5 C A 17: 43,422,640 N118K possibly damaging Het
Baz2b A T 2: 59,924,666 Y1073N possibly damaging Het
Celf2 T C 2: 6,604,125 R282G probably damaging Het
Cntnap5c A T 17: 57,876,392 D31V probably damaging Het
Cobl A G 11: 12,378,342 L81P probably damaging Het
Cpsf1 A T 15: 76,602,851 L209Q probably damaging Het
Crocc G A 4: 141,018,756 A1684V probably damaging Het
Cyp4f37 T A 17: 32,629,125 C206S probably damaging Het
Diexf A T 1: 193,128,451 N81K probably benign Het
Dnah3 A G 7: 119,967,938 V2355A probably benign Het
Dnah6 T C 6: 73,129,331 K1756E probably benign Het
Fis1 T C 5: 136,963,117 I55T possibly damaging Het
Gm2381 G A 7: 42,820,407 P98S probably damaging Het
Gpr37 C T 6: 25,666,946 probably benign Het
Grin2a A G 16: 9,761,965 F145L possibly damaging Het
Htr4 T C 18: 62,428,126 S153P probably damaging Het
Igkv9-120 T A 6: 68,050,144 probably benign Het
Il12rb1 G A 8: 70,815,802 W396* probably null Het
Itga8 A T 2: 12,160,404 V798D probably damaging Het
Lfng T A 5: 140,611,867 D149E probably damaging Het
Magi2 A AG 5: 20,602,461 probably null Het
Mgam C A 6: 40,652,715 A86E possibly damaging Het
Myh4 A G 11: 67,248,633 N592S probably benign Het
Naa16 A G 14: 79,335,883 C816R probably damaging Het
Nek8 A G 11: 78,168,141 S513P probably damaging Het
Ociad1 A G 5: 73,294,351 probably null Het
Olfr1288 T C 2: 111,479,354 M190T probably benign Het
Olfr350 A G 2: 36,850,799 Y251C probably damaging Het
Olfr721-ps1 C T 14: 14,407,398 P57S probably damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Pcdh7 G A 5: 57,720,276 G391E probably damaging Het
Pcdhga10 T A 18: 37,748,200 V338E possibly damaging Het
Peg10 C T 6: 4,756,912 probably benign Het
Poteg A T 8: 27,481,676 N406I probably benign Het
Ppargc1a A G 5: 51,473,809 F493L probably benign Het
Ptpra C A 2: 130,544,999 H603Q probably benign Het
Rnf10 T C 5: 115,249,112 D439G probably benign Het
Syt3 G A 7: 44,393,442 V383I probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Try5 C T 6: 41,313,476 V25I probably benign Het
Ttn G T 2: 76,919,207 Q3833K probably benign Het
Usp53 G A 3: 122,934,491 P814L probably benign Het
Vmn1r181 G T 7: 23,984,518 S136I possibly damaging Het
Vmn2r114 A T 17: 23,290,974 M844K probably benign Het
Vwa8 G T 14: 78,947,142 R360L probably benign Het
Xlr4b A T X: 73,215,332 Q25L probably null Het
Zfp532 T A 18: 65,656,626 H1045Q possibly damaging Het
Zfp985 G A 4: 147,583,011 W112* probably null Het
Other mutations in Pde4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Pde4b APN 4 102506044 critical splice donor site probably null
IGL01146:Pde4b APN 4 102255263 missense possibly damaging 0.80
IGL01377:Pde4b APN 4 102487402 missense probably damaging 1.00
IGL01549:Pde4b APN 4 102605068 missense probably damaging 0.97
IGL01739:Pde4b APN 4 102601635 missense probably damaging 0.97
IGL01791:Pde4b APN 4 102590930 splice site probably benign
IGL02211:Pde4b APN 4 102590822 splice site probably benign
IGL02578:Pde4b APN 4 102255297 missense possibly damaging 0.94
IGL02878:Pde4b APN 4 102601639 missense probably damaging 1.00
PIT4458001:Pde4b UTSW 4 102602678 missense probably damaging 1.00
PIT4618001:Pde4b UTSW 4 102602812 missense probably benign 0.09
R0102:Pde4b UTSW 4 102590178 missense probably benign 0.15
R0230:Pde4b UTSW 4 102597510 missense probably benign 0.01
R0530:Pde4b UTSW 4 102602651 missense probably damaging 0.96
R0704:Pde4b UTSW 4 102487392 missense probably damaging 0.99
R1115:Pde4b UTSW 4 102542155 intron probably benign
R1450:Pde4b UTSW 4 102601635 missense probably damaging 0.97
R1457:Pde4b UTSW 4 102605176 missense probably damaging 0.99
R1568:Pde4b UTSW 4 102597699 missense probably damaging 1.00
R1740:Pde4b UTSW 4 102487351 missense probably damaging 1.00
R1784:Pde4b UTSW 4 102605260 missense probably benign 0.02
R1960:Pde4b UTSW 4 102597460 missense probably damaging 0.99
R1961:Pde4b UTSW 4 102597460 missense probably damaging 0.99
R2033:Pde4b UTSW 4 102605295 missense probably benign 0.43
R2210:Pde4b UTSW 4 102597475 missense probably damaging 1.00
R2936:Pde4b UTSW 4 102601545 missense probably damaging 1.00
R3195:Pde4b UTSW 4 102599643 missense probably damaging 0.99
R3196:Pde4b UTSW 4 102599643 missense probably damaging 0.99
R3695:Pde4b UTSW 4 102601545 missense probably damaging 1.00
R3699:Pde4b UTSW 4 102601545 missense probably damaging 1.00
R4014:Pde4b UTSW 4 102555625 missense probably benign 0.00
R4627:Pde4b UTSW 4 102601605 missense probably damaging 1.00
R4852:Pde4b UTSW 4 102597770 missense probably damaging 1.00
R5055:Pde4b UTSW 4 102195114 intron probably benign
R5109:Pde4b UTSW 4 102601544 missense probably damaging 1.00
R5319:Pde4b UTSW 4 102421788 utr 3 prime probably benign
R5476:Pde4b UTSW 4 102602699 missense probably benign 0.00
R5576:Pde4b UTSW 4 102430162 missense probably damaging 0.98
R6019:Pde4b UTSW 4 102570769 missense possibly damaging 0.56
R6151:Pde4b UTSW 4 102601551 missense probably damaging 1.00
R6540:Pde4b UTSW 4 102601876 missense probably damaging 1.00
R6573:Pde4b UTSW 4 102430162 missense probably damaging 0.98
R6662:Pde4b UTSW 4 102601898 missense possibly damaging 0.82
R6751:Pde4b UTSW 4 102602671 missense probably damaging 0.98
R7066:Pde4b UTSW 4 102602806 missense probably benign 0.03
R7092:Pde4b UTSW 4 102601851 missense probably damaging 1.00
R7461:Pde4b UTSW 4 102255306 missense probably damaging 1.00
R7613:Pde4b UTSW 4 102255306 missense probably damaging 1.00
R8068:Pde4b UTSW 4 102596015 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAATTGTCAGAGGTTGGGG -3'
(R):5'- TGCCAACACCTTGAGCAAAG -3'

Sequencing Primer
(F):5'- CATTTGATAACGCATCTGTGTTTTC -3'
(R):5'- CCTTGAGCAAAGACAGAATTAAAAC -3'
Posted On2014-12-04