Incidental Mutation 'R2509:Prkca'
ID251809
Institutional Source Beutler Lab
Gene Symbol Prkca
Ensembl Gene ENSMUSG00000050965
Gene Nameprotein kinase C, alpha
SynonymsPkca
MMRRC Submission 040415-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.758) question?
Stock #R2509 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location107933387-108343928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107979206 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 37 (Y37C)
Ref Sequence ENSEMBL: ENSMUSP00000097875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059595] [ENSMUST00000100302]
Predicted Effect probably damaging
Transcript: ENSMUST00000059595
AA Change: Y461C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062392
Gene: ENSMUSG00000050965
AA Change: Y461C

DomainStartEndE-ValueType
C1 37 86 3.09e-16 SMART
C1 102 151 1.33e-15 SMART
C2 172 275 7.66e-26 SMART
S_TKc 339 597 8.85e-98 SMART
S_TK_X 598 660 1.58e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100302
AA Change: Y37C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097875
Gene: ENSMUSG00000050965
AA Change: Y37C

DomainStartEndE-ValueType
Pfam:Pkinase 2 173 9.3e-44 PFAM
Pfam:Pkinase_Tyr 3 159 3.7e-25 PFAM
S_TK_X 174 236 1.58e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134910
Meta Mutation Damage Score 0.9235 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (105/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show no overt macroscopic abnormalities, however examination of one line revealed increased cardiac muscle contractility and protection against heart failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,406,453 I497V probably benign Het
2010300C02Rik T C 1: 37,625,300 M506V probably benign Het
4930571K23Rik C A 7: 125,369,139 noncoding transcript Het
Abca17 G T 17: 24,289,613 probably benign Het
Ablim1 C T 19: 57,152,359 R196Q probably damaging Het
Acot11 T C 4: 106,755,319 I379V possibly damaging Het
Acot4 G A 12: 84,041,873 G165D probably damaging Het
Agrn A T 4: 156,166,424 probably null Het
Ahctf1 T C 1: 179,770,693 S945G possibly damaging Het
Akr1c13 C T 13: 4,198,584 R263C probably damaging Het
Arfgap1 T A 2: 180,974,053 probably benign Het
Arhgef3 A G 14: 27,379,676 K103R probably damaging Het
Cabp1 A T 5: 115,172,784 N211K probably damaging Het
Cacna1c T A 6: 118,734,982 D261V probably damaging Het
Car11 G A 7: 45,701,359 G93E probably damaging Het
Card10 A G 15: 78,780,273 I821T probably benign Het
Cast T C 13: 74,737,616 I277V probably benign Het
Cenpj T C 14: 56,532,237 K1165R probably null Het
Cenpk A G 13: 104,234,167 probably null Het
Cmya5 T C 13: 93,093,558 Q1674R probably benign Het
Cnnm1 T A 19: 43,441,886 V481D probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2c50 G A 19: 40,090,569 V119I probably benign Het
Dnah7b A G 1: 46,195,287 T1460A probably damaging Het
Dnah8 G A 17: 30,775,045 D3379N probably benign Het
Dnajc4 C T 19: 6,990,743 R55H probably damaging Het
Ebf4 C T 2: 130,306,562 R98* probably null Het
Epha4 G A 1: 77,511,702 A47V possibly damaging Het
Ercc8 T C 13: 108,183,717 probably benign Het
Exo1 T C 1: 175,905,833 F75S probably damaging Het
Fam168a G T 7: 100,834,184 probably null Het
Fat3 G A 9: 15,925,014 R4065W possibly damaging Het
Gm10639 T A 9: 78,294,807 M1K probably null Het
Gm13103 G A 4: 143,851,991 V274I probably benign Het
Gm5431 T A 11: 48,888,709 N740I probably benign Het
Gm5900 T A 7: 104,950,364 noncoding transcript Het
Gpi1 A G 7: 34,205,923 S359P probably damaging Het
Gpr156 A G 16: 37,947,787 R22G probably benign Het
Greb1 A G 12: 16,724,922 V158A probably damaging Het
Grin2c T A 11: 115,251,068 K842* probably null Het
Hnf4a T A 2: 163,566,241 L329Q probably damaging Het
Hsp90ab1 A G 17: 45,569,341 L92P probably damaging Het
Ido1 T A 8: 24,584,485 R290* probably null Het
Ifnlr1 G T 4: 135,705,248 D332Y probably damaging Het
Ift172 T C 5: 31,262,968 N1108S probably benign Het
Igkv3-9 T A 6: 70,588,744 M109K probably benign Het
Igsf10 T C 3: 59,331,866 D298G probably damaging Het
Iqck T G 7: 118,876,282 M98R probably benign Het
Klk1b1 T C 7: 43,969,379 V60A probably damaging Het
Krtap1-3 C T 11: 99,590,827 E165K unknown Het
Lair1 A G 7: 4,010,783 L155P probably damaging Het
Mast4 G T 13: 102,853,842 S57Y probably damaging Het
Mical3 T C 6: 121,034,157 H360R probably damaging Het
Muc5b A T 7: 141,859,061 N1915Y unknown Het
Myh1 A G 11: 67,205,597 I301V probably benign Het
Nck2 T A 1: 43,554,233 V200E probably damaging Het
Olfr10 T G 11: 49,318,221 L225R probably damaging Het
Olfr1214 T G 2: 88,987,431 Y257S probably damaging Het
Olfr1271 T C 2: 90,265,686 Y248C possibly damaging Het
Olfr1282 C T 2: 111,335,731 V116I probably damaging Het
Olfr1313 T A 2: 112,072,492 L30F probably benign Het
Olfr1453 T A 19: 13,027,694 I212F probably damaging Het
Olfr668 G A 7: 104,925,687 H26Y probably benign Het
Olfr870 A G 9: 20,171,229 L114P probably damaging Het
Otoa C T 7: 121,160,472 T1099I probably benign Het
Pask T A 1: 93,330,763 I288F possibly damaging Het
Pcnx4 T C 12: 72,566,972 W564R probably damaging Het
Pitpnm2 T C 5: 124,136,326 E240G probably damaging Het
Ppp1r16b A G 2: 158,761,463 Y436C possibly damaging Het
Rad18 T G 6: 112,675,922 H238P possibly damaging Het
Rap1b T A 10: 117,818,539 Q1L probably damaging Het
Rgs9 T C 11: 109,268,972 Y178C probably benign Het
Rpl3l A T 17: 24,732,386 D87V possibly damaging Het
Scrn2 T C 11: 97,033,166 V292A possibly damaging Het
Sdad1 A G 5: 92,305,825 Y35H probably benign Het
Sez6l2 T C 7: 126,953,772 S177P probably benign Het
Sh3bp1 C T 15: 78,911,506 P612S probably damaging Het
Shank1 T C 7: 44,351,724 S956P unknown Het
Shank1 G A 7: 44,352,123 A1089T unknown Het
Shprh G A 10: 11,166,724 C817Y probably damaging Het
Spata22 C T 11: 73,345,767 P300S probably damaging Het
Sstr2 A T 11: 113,624,923 I223F probably damaging Het
Stom C T 2: 35,320,342 A217T probably damaging Het
Stpg1 T C 4: 135,536,649 V341A probably benign Het
Tagap A G 17: 7,928,754 T99A probably benign Het
Tas1r2 A G 4: 139,659,851 N207S probably damaging Het
Thbs2 A G 17: 14,685,843 V265A probably benign Het
Thyn1 A G 9: 27,000,020 R3G possibly damaging Het
Tia1 T A 6: 86,424,330 probably null Het
Tktl2 A G 8: 66,512,852 E354G probably benign Het
Tmc8 A G 11: 117,792,685 T689A possibly damaging Het
Tmem11 A T 11: 60,864,981 probably null Het
Tmem55b A T 14: 50,929,658 Y129* probably null Het
Tmem57 A G 4: 134,804,388 S657P probably damaging Het
Tnik T C 3: 28,667,915 V1310A probably damaging Het
Trappc10 A G 10: 78,211,523 S380P possibly damaging Het
Trim8 C T 19: 46,515,295 P429S probably benign Het
Ttc25 T G 11: 100,553,535 L222R probably damaging Het
Ttn C A 2: 76,857,412 probably benign Het
Ulk2 T C 11: 61,787,514 Y793C probably benign Het
Vill G A 9: 119,070,302 V337M possibly damaging Het
Vps53 C A 11: 76,066,835 V364F possibly damaging Het
Wdr66 A G 5: 123,256,106 K353E probably benign Het
Zan A T 5: 137,456,586 I1396N unknown Het
Zfa-ps A C 10: 52,544,243 noncoding transcript Het
Zfp426 T C 9: 20,470,681 T337A possibly damaging Het
Zfp536 T C 7: 37,567,978 E671G possibly damaging Het
Zfp985 A G 4: 147,582,986 T104A possibly damaging Het
Other mutations in Prkca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Prkca APN 11 108343508 missense probably benign 0.10
IGL00903:Prkca APN 11 107983974 missense probably damaging 1.00
IGL01385:Prkca APN 11 107978352 missense probably damaging 1.00
IGL01396:Prkca APN 11 108014322 missense possibly damaging 0.59
IGL01480:Prkca APN 11 108192201 missense probably damaging 1.00
IGL01480:Prkca APN 11 107986289 missense possibly damaging 0.93
IGL01516:Prkca APN 11 107961602 missense probably null 1.00
IGL01553:Prkca APN 11 108057834 missense probably benign 0.15
IGL02975:Prkca APN 11 108340677 nonsense probably null
IGL03402:Prkca APN 11 108340663 missense probably benign 0.20
R0101:Prkca UTSW 11 108057800 missense probably damaging 1.00
R0279:Prkca UTSW 11 108054111 splice site probably benign
R0454:Prkca UTSW 11 107978280 missense probably benign
R0513:Prkca UTSW 11 108014376 missense possibly damaging 0.82
R0711:Prkca UTSW 11 107981654 missense probably benign 0.16
R0894:Prkca UTSW 11 108012692 missense possibly damaging 0.66
R0966:Prkca UTSW 11 108014284 missense possibly damaging 0.56
R1432:Prkca UTSW 11 107939520 missense probably benign 0.27
R1518:Prkca UTSW 11 107978316 missense probably damaging 1.00
R1667:Prkca UTSW 11 107983946 missense probably damaging 1.00
R1795:Prkca UTSW 11 108012692 missense possibly damaging 0.66
R1909:Prkca UTSW 11 107939612 missense possibly damaging 0.68
R1932:Prkca UTSW 11 108192149 missense probably benign 0.13
R3889:Prkca UTSW 11 107979240 missense probably damaging 1.00
R4018:Prkca UTSW 11 107939602 missense probably damaging 1.00
R4684:Prkca UTSW 11 107961608 missense probably damaging 0.99
R5132:Prkca UTSW 11 108192117 splice site probably benign
R5298:Prkca UTSW 11 108012684 missense probably damaging 0.98
R5546:Prkca UTSW 11 108053980 missense probably benign 0.14
R5558:Prkca UTSW 11 107981647 missense probably damaging 1.00
R5616:Prkca UTSW 11 107978343 missense possibly damaging 0.85
R5626:Prkca UTSW 11 108057815 missense possibly damaging 0.94
R5931:Prkca UTSW 11 108014310 missense probably benign 0.01
R6061:Prkca UTSW 11 108057845 missense probably benign 0.03
R7125:Prkca UTSW 11 107984022 missense probably damaging 1.00
R7283:Prkca UTSW 11 108340645 critical splice donor site probably null
R7329:Prkca UTSW 11 108014277 missense possibly damaging 0.73
R7510:Prkca UTSW 11 107983994 missense possibly damaging 0.89
R7670:Prkca UTSW 11 108014344 missense probably damaging 0.98
R7890:Prkca UTSW 11 108012684 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAGCCTCCAAGCAAAGCAG -3'
(R):5'- GTAGGGAATAAGTGAGCTCCTC -3'

Sequencing Primer
(F):5'- GCAGTGGCTCTGGTTTGC -3'
(R):5'- TGATCTCAGAGAGCGTTAGGATC -3'
Posted On2014-12-04