Incidental Mutation 'R2848:Ppargc1a'
ID251814
Institutional Source Beutler Lab
Gene Symbol Ppargc1a
Ensembl Gene ENSMUSG00000029167
Gene Nameperoxisome proliferative activated receptor, gamma, coactivator 1 alpha
SynonymsA830037N07Rik, Gm11133, Pgco1, Pgc1, PPAR Gamma Coactivator-1, Pgc-1alpha, Pgc-1alphaa
MMRRC Submission 040441-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.729) question?
Stock #R2848 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location51454250-51567726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51473809 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 493 (F493L)
Ref Sequence ENSEMBL: ENSMUSP00000117040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031059] [ENSMUST00000132734] [ENSMUST00000151104] [ENSMUST00000196968]
PDB Structure
SF-1 LBD bound by phosphatidylcholine [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000031059
SMART Domains Protein: ENSMUSP00000138397
Gene: ENSMUSG00000029167

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
low complexity region 141 147 N/A INTRINSIC
PDB:3D24|D 197 218 1e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000132734
AA Change: F493L

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000117040
Gene: ENSMUSG00000029167
AA Change: F493L

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
low complexity region 141 147 N/A INTRINSIC
PDB:3D24|D 197 218 4e-7 PDB
low complexity region 294 300 N/A INTRINSIC
low complexity region 558 613 N/A INTRINSIC
low complexity region 615 636 N/A INTRINSIC
RRM 677 746 4.61e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151104
SMART Domains Protein: ENSMUSP00000116566
Gene: ENSMUSG00000029167

DomainStartEndE-ValueType
low complexity region 19 36 N/A INTRINSIC
low complexity region 137 143 N/A INTRINSIC
PDB:3D24|D 193 214 1e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000196968
AA Change: F493L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000143553
Gene: ENSMUSG00000029167
AA Change: F493L

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
low complexity region 141 147 N/A INTRINSIC
PDB:3D24|D 197 218 4e-7 PDB
low complexity region 294 300 N/A INTRINSIC
low complexity region 558 613 N/A INTRINSIC
low complexity region 615 636 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a transcriptional coactivator that induces and coordinates gene expression regulating mitochondrial biogenesis, respiration, hepatic gluconeogenesis, thermogenic program in brown fat and muscle fiber-type switching. Mice lacking the encoded protein exhibit reduced thermogenic capacity, hyperactivity and resistance to diet-induced obesity. Mice lacking the encoded protein specifically in the heart exhibit peripartum cardiomyopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice display partial postnatal lethality, abnormal glucose and insulin homeostasis, resistance to diet induced obesity, increased oxygen consumption, spongiform encephalopathy, hyperactivity, increased startle reflex, and limb grasping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451I11Rik A T 7: 126,830,722 F101Y possibly damaging Het
A230050P20Rik A T 9: 20,873,572 H225L probably damaging Het
Abca17 G C 17: 24,289,507 T1018R probably damaging Het
Adamts14 T A 10: 61,218,435 Q606L probably damaging Het
Adgrf5 C A 17: 43,422,640 N118K possibly damaging Het
Baz2b A T 2: 59,924,666 Y1073N possibly damaging Het
Celf2 T C 2: 6,604,125 R282G probably damaging Het
Cntnap5c A T 17: 57,876,392 D31V probably damaging Het
Cobl A G 11: 12,378,342 L81P probably damaging Het
Cpsf1 A T 15: 76,602,851 L209Q probably damaging Het
Crocc G A 4: 141,018,756 A1684V probably damaging Het
Cyp4f37 T A 17: 32,629,125 C206S probably damaging Het
Diexf A T 1: 193,128,451 N81K probably benign Het
Dnah3 A G 7: 119,967,938 V2355A probably benign Het
Dnah6 T C 6: 73,129,331 K1756E probably benign Het
Fis1 T C 5: 136,963,117 I55T possibly damaging Het
Gm2381 G A 7: 42,820,407 P98S probably damaging Het
Gpr37 C T 6: 25,666,946 probably benign Het
Grin2a A G 16: 9,761,965 F145L possibly damaging Het
Htr4 T C 18: 62,428,126 S153P probably damaging Het
Igkv9-120 T A 6: 68,050,144 probably benign Het
Il12rb1 G A 8: 70,815,802 W396* probably null Het
Itga8 A T 2: 12,160,404 V798D probably damaging Het
Lfng T A 5: 140,611,867 D149E probably damaging Het
Magi2 A AG 5: 20,602,461 probably null Het
Mgam C A 6: 40,652,715 A86E possibly damaging Het
Myh4 A G 11: 67,248,633 N592S probably benign Het
Naa16 A G 14: 79,335,883 C816R probably damaging Het
Nek8 A G 11: 78,168,141 S513P probably damaging Het
Ociad1 A G 5: 73,294,351 probably null Het
Olfr1288 T C 2: 111,479,354 M190T probably benign Het
Olfr350 A G 2: 36,850,799 Y251C probably damaging Het
Olfr721-ps1 C T 14: 14,407,398 P57S probably damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Pcdh7 G A 5: 57,720,276 G391E probably damaging Het
Pcdhga10 T A 18: 37,748,200 V338E possibly damaging Het
Pde4b C T 4: 102,601,545 A466V probably damaging Het
Peg10 C T 6: 4,756,912 probably benign Het
Poteg A T 8: 27,481,676 N406I probably benign Het
Ptpra C A 2: 130,544,999 H603Q probably benign Het
Rnf10 T C 5: 115,249,112 D439G probably benign Het
Syt3 G A 7: 44,393,442 V383I probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Try5 C T 6: 41,313,476 V25I probably benign Het
Ttn G T 2: 76,919,207 Q3833K probably benign Het
Usp53 G A 3: 122,934,491 P814L probably benign Het
Vmn1r181 G T 7: 23,984,518 S136I possibly damaging Het
Vmn2r114 A T 17: 23,290,974 M844K probably benign Het
Vwa8 G T 14: 78,947,142 R360L probably benign Het
Xlr4b A T X: 73,215,332 Q25L probably null Het
Zfp532 T A 18: 65,656,626 H1045Q possibly damaging Het
Zfp985 G A 4: 147,583,011 W112* probably null Het
Other mutations in Ppargc1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Ppargc1a APN 5 51498031 splice site probably null
IGL01063:Ppargc1a APN 5 51474322 missense probably benign 0.43
IGL01800:Ppargc1a APN 5 51494721 missense probably damaging 1.00
IGL02179:Ppargc1a APN 5 51473711 missense possibly damaging 0.90
IGL02336:Ppargc1a APN 5 51495726 nonsense probably null
IGL02368:Ppargc1a APN 5 51474156 missense probably benign 0.05
R1300:Ppargc1a UTSW 5 51548672 missense probably damaging 1.00
R2048:Ppargc1a UTSW 5 51548516 missense probably damaging 1.00
R2054:Ppargc1a UTSW 5 51473788 missense possibly damaging 0.47
R2211:Ppargc1a UTSW 5 51474259 missense possibly damaging 0.47
R4094:Ppargc1a UTSW 5 51490064 missense possibly damaging 0.47
R4419:Ppargc1a UTSW 5 51494702 missense probably damaging 1.00
R4552:Ppargc1a UTSW 5 51463215 intron probably benign
R4702:Ppargc1a UTSW 5 51495696 missense possibly damaging 0.73
R4855:Ppargc1a UTSW 5 51474222 missense possibly damaging 0.89
R5287:Ppargc1a UTSW 5 51462825 intron probably benign
R5313:Ppargc1a UTSW 5 51458239 utr 3 prime probably benign
R5403:Ppargc1a UTSW 5 51462825 intron probably benign
R5711:Ppargc1a UTSW 5 51474220 missense probably damaging 1.00
R5918:Ppargc1a UTSW 5 51463237 intron probably benign
R5940:Ppargc1a UTSW 5 51473911 missense probably damaging 1.00
R6170:Ppargc1a UTSW 5 51473911 missense probably damaging 1.00
R6415:Ppargc1a UTSW 5 51462834 intron probably benign
R7718:Ppargc1a UTSW 5 51498162 missense probably damaging 1.00
R7755:Ppargc1a UTSW 5 51473541 missense unknown
R7849:Ppargc1a UTSW 5 51548513 missense probably benign 0.45
R7932:Ppargc1a UTSW 5 51548513 missense probably benign 0.45
X0019:Ppargc1a UTSW 5 51548678 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACGAGAGCGCATCCTTTG -3'
(R):5'- AGACTTTGGAGGCCAGCAAG -3'

Sequencing Primer
(F):5'- CCTTTGGGGTCTTTGAGAAAATAAG -3'
(R):5'- AGCAAGCAGGTCTCTCCTTG -3'
Posted On2014-12-04