Incidental Mutation 'R2509:Greb1'
ID251823
Institutional Source Beutler Lab
Gene Symbol Greb1
Ensembl Gene ENSMUSG00000036523
Gene Namegene regulated by estrogen in breast cancer protein
Synonyms5730583K22Rik
MMRRC Submission 040415-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2509 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location16670615-16800886 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16724922 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 158 (V158A)
Ref Sequence ENSEMBL: ENSMUSP00000125339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000162112]
Predicted Effect probably damaging
Transcript: ENSMUST00000048064
AA Change: V158A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523
AA Change: V158A

DomainStartEndE-ValueType
Pfam:GREB1 1 1954 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159120
AA Change: V158A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523
AA Change: V158A

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1596 1607 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161036
Predicted Effect probably damaging
Transcript: ENSMUST00000162112
AA Change: V158A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523
AA Change: V158A

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1128 1146 N/A INTRINSIC
low complexity region 1224 1235 N/A INTRINSIC
low complexity region 1279 1293 N/A INTRINSIC
low complexity region 1624 1635 N/A INTRINSIC
Meta Mutation Damage Score 0.1138 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (105/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,406,453 I497V probably benign Het
2010300C02Rik T C 1: 37,625,300 M506V probably benign Het
4930571K23Rik C A 7: 125,369,139 noncoding transcript Het
Abca17 G T 17: 24,289,613 probably benign Het
Ablim1 C T 19: 57,152,359 R196Q probably damaging Het
Acot11 T C 4: 106,755,319 I379V possibly damaging Het
Acot4 G A 12: 84,041,873 G165D probably damaging Het
Agrn A T 4: 156,166,424 probably null Het
Ahctf1 T C 1: 179,770,693 S945G possibly damaging Het
Akr1c13 C T 13: 4,198,584 R263C probably damaging Het
Arfgap1 T A 2: 180,974,053 probably benign Het
Arhgef3 A G 14: 27,379,676 K103R probably damaging Het
Cabp1 A T 5: 115,172,784 N211K probably damaging Het
Cacna1c T A 6: 118,734,982 D261V probably damaging Het
Car11 G A 7: 45,701,359 G93E probably damaging Het
Card10 A G 15: 78,780,273 I821T probably benign Het
Cast T C 13: 74,737,616 I277V probably benign Het
Cenpj T C 14: 56,532,237 K1165R probably null Het
Cenpk A G 13: 104,234,167 probably null Het
Cmya5 T C 13: 93,093,558 Q1674R probably benign Het
Cnnm1 T A 19: 43,441,886 V481D probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2c50 G A 19: 40,090,569 V119I probably benign Het
Dnah7b A G 1: 46,195,287 T1460A probably damaging Het
Dnah8 G A 17: 30,775,045 D3379N probably benign Het
Dnajc4 C T 19: 6,990,743 R55H probably damaging Het
Ebf4 C T 2: 130,306,562 R98* probably null Het
Epha4 G A 1: 77,511,702 A47V possibly damaging Het
Ercc8 T C 13: 108,183,717 probably benign Het
Exo1 T C 1: 175,905,833 F75S probably damaging Het
Fam168a G T 7: 100,834,184 probably null Het
Fat3 G A 9: 15,925,014 R4065W possibly damaging Het
Gm10639 T A 9: 78,294,807 M1K probably null Het
Gm13103 G A 4: 143,851,991 V274I probably benign Het
Gm5431 T A 11: 48,888,709 N740I probably benign Het
Gm5900 T A 7: 104,950,364 noncoding transcript Het
Gpi1 A G 7: 34,205,923 S359P probably damaging Het
Gpr156 A G 16: 37,947,787 R22G probably benign Het
Grin2c T A 11: 115,251,068 K842* probably null Het
Hnf4a T A 2: 163,566,241 L329Q probably damaging Het
Hsp90ab1 A G 17: 45,569,341 L92P probably damaging Het
Ido1 T A 8: 24,584,485 R290* probably null Het
Ifnlr1 G T 4: 135,705,248 D332Y probably damaging Het
Ift172 T C 5: 31,262,968 N1108S probably benign Het
Igkv3-9 T A 6: 70,588,744 M109K probably benign Het
Igsf10 T C 3: 59,331,866 D298G probably damaging Het
Iqck T G 7: 118,876,282 M98R probably benign Het
Klk1b1 T C 7: 43,969,379 V60A probably damaging Het
Krtap1-3 C T 11: 99,590,827 E165K unknown Het
Lair1 A G 7: 4,010,783 L155P probably damaging Het
Mast4 G T 13: 102,853,842 S57Y probably damaging Het
Mical3 T C 6: 121,034,157 H360R probably damaging Het
Muc5b A T 7: 141,859,061 N1915Y unknown Het
Myh1 A G 11: 67,205,597 I301V probably benign Het
Nck2 T A 1: 43,554,233 V200E probably damaging Het
Olfr10 T G 11: 49,318,221 L225R probably damaging Het
Olfr1214 T G 2: 88,987,431 Y257S probably damaging Het
Olfr1271 T C 2: 90,265,686 Y248C possibly damaging Het
Olfr1282 C T 2: 111,335,731 V116I probably damaging Het
Olfr1313 T A 2: 112,072,492 L30F probably benign Het
Olfr1453 T A 19: 13,027,694 I212F probably damaging Het
Olfr668 G A 7: 104,925,687 H26Y probably benign Het
Olfr870 A G 9: 20,171,229 L114P probably damaging Het
Otoa C T 7: 121,160,472 T1099I probably benign Het
Pask T A 1: 93,330,763 I288F possibly damaging Het
Pcnx4 T C 12: 72,566,972 W564R probably damaging Het
Pitpnm2 T C 5: 124,136,326 E240G probably damaging Het
Ppp1r16b A G 2: 158,761,463 Y436C possibly damaging Het
Prkca T C 11: 107,979,206 Y37C probably damaging Het
Rad18 T G 6: 112,675,922 H238P possibly damaging Het
Rap1b T A 10: 117,818,539 Q1L probably damaging Het
Rgs9 T C 11: 109,268,972 Y178C probably benign Het
Rpl3l A T 17: 24,732,386 D87V possibly damaging Het
Scrn2 T C 11: 97,033,166 V292A possibly damaging Het
Sdad1 A G 5: 92,305,825 Y35H probably benign Het
Sez6l2 T C 7: 126,953,772 S177P probably benign Het
Sh3bp1 C T 15: 78,911,506 P612S probably damaging Het
Shank1 T C 7: 44,351,724 S956P unknown Het
Shank1 G A 7: 44,352,123 A1089T unknown Het
Shprh G A 10: 11,166,724 C817Y probably damaging Het
Spata22 C T 11: 73,345,767 P300S probably damaging Het
Sstr2 A T 11: 113,624,923 I223F probably damaging Het
Stom C T 2: 35,320,342 A217T probably damaging Het
Stpg1 T C 4: 135,536,649 V341A probably benign Het
Tagap A G 17: 7,928,754 T99A probably benign Het
Tas1r2 A G 4: 139,659,851 N207S probably damaging Het
Thbs2 A G 17: 14,685,843 V265A probably benign Het
Thyn1 A G 9: 27,000,020 R3G possibly damaging Het
Tia1 T A 6: 86,424,330 probably null Het
Tktl2 A G 8: 66,512,852 E354G probably benign Het
Tmc8 A G 11: 117,792,685 T689A possibly damaging Het
Tmem11 A T 11: 60,864,981 probably null Het
Tmem55b A T 14: 50,929,658 Y129* probably null Het
Tmem57 A G 4: 134,804,388 S657P probably damaging Het
Tnik T C 3: 28,667,915 V1310A probably damaging Het
Trappc10 A G 10: 78,211,523 S380P possibly damaging Het
Trim8 C T 19: 46,515,295 P429S probably benign Het
Ttc25 T G 11: 100,553,535 L222R probably damaging Het
Ttn C A 2: 76,857,412 probably benign Het
Ulk2 T C 11: 61,787,514 Y793C probably benign Het
Vill G A 9: 119,070,302 V337M possibly damaging Het
Vps53 C A 11: 76,066,835 V364F possibly damaging Het
Wdr66 A G 5: 123,256,106 K353E probably benign Het
Zan A T 5: 137,456,586 I1396N unknown Het
Zfa-ps A C 10: 52,544,243 noncoding transcript Het
Zfp426 T C 9: 20,470,681 T337A possibly damaging Het
Zfp536 T C 7: 37,567,978 E671G possibly damaging Het
Zfp985 A G 4: 147,582,986 T104A possibly damaging Het
Other mutations in Greb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Greb1 APN 12 16711961 missense probably damaging 1.00
IGL01316:Greb1 APN 12 16698586 missense probably benign 0.04
IGL01464:Greb1 APN 12 16714826 missense probably damaging 0.99
IGL01474:Greb1 APN 12 16684501 missense probably benign
IGL01522:Greb1 APN 12 16701201 missense probably damaging 1.00
IGL01824:Greb1 APN 12 16711716 nonsense probably null
IGL01837:Greb1 APN 12 16684451 missense probably benign 0.19
IGL01991:Greb1 APN 12 16699681 missense probably damaging 1.00
IGL01996:Greb1 APN 12 16690845 missense possibly damaging 0.70
IGL02213:Greb1 APN 12 16706232 missense probably damaging 1.00
IGL02267:Greb1 APN 12 16717208 missense probably benign 0.00
IGL02512:Greb1 APN 12 16692712 missense possibly damaging 0.79
IGL02583:Greb1 APN 12 16706295 splice site probably benign
IGL02613:Greb1 APN 12 16739888 critical splice donor site probably null
IGL02648:Greb1 APN 12 16708682 missense probably damaging 1.00
IGL02679:Greb1 APN 12 16708723 missense probably damaging 1.00
Eared UTSW 12 16673863 missense probably damaging 1.00
Humpback UTSW 12 16701171 missense probably damaging 1.00
pied_billed UTSW 12 16724857 missense possibly damaging 0.79
G1patch:Greb1 UTSW 12 16688567 missense probably damaging 1.00
IGL03048:Greb1 UTSW 12 16733331 missense probably damaging 1.00
R0083:Greb1 UTSW 12 16696451 missense probably benign
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0220:Greb1 UTSW 12 16682286 missense probably damaging 1.00
R0245:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0540:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0547:Greb1 UTSW 12 16723411 missense probably benign
R0563:Greb1 UTSW 12 16680267 missense probably benign 0.23
R0607:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0610:Greb1 UTSW 12 16696442 missense probably benign
R0652:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0659:Greb1 UTSW 12 16680212 missense probably damaging 0.99
R0945:Greb1 UTSW 12 16673802 missense probably benign 0.31
R1055:Greb1 UTSW 12 16682251 missense probably damaging 0.98
R1445:Greb1 UTSW 12 16707851 missense probably damaging 1.00
R1471:Greb1 UTSW 12 16711774 missense probably damaging 0.97
R1503:Greb1 UTSW 12 16724819 nonsense probably null
R1566:Greb1 UTSW 12 16711828 missense possibly damaging 0.94
R1614:Greb1 UTSW 12 16701171 missense probably damaging 1.00
R1623:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R1751:Greb1 UTSW 12 16723438 splice site probably benign
R1778:Greb1 UTSW 12 16690894 missense probably benign
R1842:Greb1 UTSW 12 16696243 missense probably damaging 1.00
R2040:Greb1 UTSW 12 16702650 missense probably damaging 1.00
R2153:Greb1 UTSW 12 16699532 missense probably damaging 1.00
R2178:Greb1 UTSW 12 16696387 missense probably damaging 1.00
R2194:Greb1 UTSW 12 16690908 missense probably benign 0.08
R2248:Greb1 UTSW 12 16680378 missense possibly damaging 0.90
R2474:Greb1 UTSW 12 16714953 missense possibly damaging 0.93
R2860:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2861:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2862:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2866:Greb1 UTSW 12 16699550 missense probably damaging 1.00
R2890:Greb1 UTSW 12 16704478 missense probably damaging 1.00
R3056:Greb1 UTSW 12 16688591 missense probably damaging 0.96
R3863:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3864:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3956:Greb1 UTSW 12 16682299 missense probably damaging 1.00
R4493:Greb1 UTSW 12 16698610 missense probably benign 0.14
R4548:Greb1 UTSW 12 16699675 missense probably damaging 1.00
R4683:Greb1 UTSW 12 16711773 missense possibly damaging 0.75
R4739:Greb1 UTSW 12 16696328 missense probably damaging 1.00
R4770:Greb1 UTSW 12 16681356 missense probably benign 0.03
R4838:Greb1 UTSW 12 16684360 critical splice donor site probably null
R4925:Greb1 UTSW 12 16681471 missense probably damaging 1.00
R4982:Greb1 UTSW 12 16724761 missense probably damaging 0.98
R5009:Greb1 UTSW 12 16724857 missense possibly damaging 0.79
R5086:Greb1 UTSW 12 16708022 intron probably benign
R5213:Greb1 UTSW 12 16714790 nonsense probably null
R5310:Greb1 UTSW 12 16716759 missense probably benign 0.09
R5353:Greb1 UTSW 12 16688566 nonsense probably null
R5544:Greb1 UTSW 12 16673796 missense probably damaging 1.00
R5605:Greb1 UTSW 12 16708726 missense probably damaging 0.96
R5708:Greb1 UTSW 12 16673842 missense probably benign 0.11
R5837:Greb1 UTSW 12 16688585 missense probably damaging 1.00
R5890:Greb1 UTSW 12 16733421 missense possibly damaging 0.90
R5938:Greb1 UTSW 12 16717258 missense probably damaging 1.00
R6049:Greb1 UTSW 12 16681394 missense probably damaging 0.99
R6093:Greb1 UTSW 12 16684486 missense probably benign
R6120:Greb1 UTSW 12 16708621 missense probably damaging 0.99
R6175:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R6247:Greb1 UTSW 12 16716675 missense probably damaging 1.00
R6274:Greb1 UTSW 12 16735151 missense probably damaging 0.97
R6376:Greb1 UTSW 12 16699579 missense probably damaging 0.97
R6523:Greb1 UTSW 12 16684373 missense possibly damaging 0.51
R6557:Greb1 UTSW 12 16710383 missense probably benign 0.00
R6602:Greb1 UTSW 12 16709440 missense probably benign 0.44
R6621:Greb1 UTSW 12 16692717 missense probably damaging 1.00
R6645:Greb1 UTSW 12 16698579 missense probably benign 0.07
R6725:Greb1 UTSW 12 16688567 missense probably damaging 1.00
R6750:Greb1 UTSW 12 16688583 missense probably benign 0.05
R6863:Greb1 UTSW 12 16684420 missense probably damaging 1.00
R6914:Greb1 UTSW 12 16707902 missense probably damaging 0.97
R6996:Greb1 UTSW 12 16723354 missense probably benign 0.00
R7083:Greb1 UTSW 12 16723314 missense probably benign
R7147:Greb1 UTSW 12 16733427 missense probably damaging 1.00
R7238:Greb1 UTSW 12 16674672 missense probably damaging 0.99
R7290:Greb1 UTSW 12 16711738 missense probably damaging 1.00
R7358:Greb1 UTSW 12 16724881 missense probably damaging 1.00
R7395:Greb1 UTSW 12 16709430 critical splice donor site probably null
R7526:Greb1 UTSW 12 16716765 missense probably benign 0.00
R7530:Greb1 UTSW 12 16717206 missense probably benign 0.02
R7536:Greb1 UTSW 12 16682185 missense probably damaging 1.00
R7643:Greb1 UTSW 12 16711996 missense probably damaging 0.99
R7732:Greb1 UTSW 12 16673863 missense probably damaging 1.00
R7740:Greb1 UTSW 12 16740121 start gained probably benign
R7747:Greb1 UTSW 12 16674795 missense probably benign 0.01
R7760:Greb1 UTSW 12 16723416 missense probably benign
R7937:Greb1 UTSW 12 16716669 missense probably damaging 0.99
R8043:Greb1 UTSW 12 16711789 missense probably damaging 1.00
R8259:Greb1 UTSW 12 16724924 nonsense probably null
R8553:Greb1 UTSW 12 16723327 missense probably benign 0.00
R8559:Greb1 UTSW 12 16696435 missense probably damaging 1.00
R8690:Greb1 UTSW 12 16696547 missense probably benign 0.03
R8830:Greb1 UTSW 12 16688519 missense probably benign 0.35
R8911:Greb1 UTSW 12 16690902 missense possibly damaging 0.84
Z1176:Greb1 UTSW 12 16696756 missense probably benign 0.00
Z1177:Greb1 UTSW 12 16702491 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATGCATACCCAGCTCCCTTC -3'
(R):5'- TCAAGCTTGCCCAGACTCTC -3'

Sequencing Primer
(F):5'- GCAGATTGCAGCCCCTC -3'
(R):5'- GGGTCCAGTCTCTTCGGTC -3'
Posted On2014-12-04